ID: 955767932

View in Genome Browser
Species Human (GRCh38)
Location 3:62364458-62364480
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955767932_955767935 6 Left 955767932 3:62364458-62364480 CCTCAATGATGGAATCAACAAGG No data
Right 955767935 3:62364487-62364509 GAAACCAGAGAATTTGTTCTGGG No data
955767932_955767937 21 Left 955767932 3:62364458-62364480 CCTCAATGATGGAATCAACAAGG No data
Right 955767937 3:62364502-62364524 GTTCTGGGTTGCTTAACTAATGG No data
955767932_955767934 5 Left 955767932 3:62364458-62364480 CCTCAATGATGGAATCAACAAGG No data
Right 955767934 3:62364486-62364508 AGAAACCAGAGAATTTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955767932 Original CRISPR CCTTGTTGATTCCATCATTG AGG (reversed) Intergenic