ID: 955767937

View in Genome Browser
Species Human (GRCh38)
Location 3:62364502-62364524
Sequence GTTCTGGGTTGCTTAACTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955767931_955767937 24 Left 955767931 3:62364455-62364477 CCACCTCAATGATGGAATCAACA No data
Right 955767937 3:62364502-62364524 GTTCTGGGTTGCTTAACTAATGG No data
955767930_955767937 28 Left 955767930 3:62364451-62364473 CCATCCACCTCAATGATGGAATC No data
Right 955767937 3:62364502-62364524 GTTCTGGGTTGCTTAACTAATGG No data
955767929_955767937 29 Left 955767929 3:62364450-62364472 CCCATCCACCTCAATGATGGAAT No data
Right 955767937 3:62364502-62364524 GTTCTGGGTTGCTTAACTAATGG No data
955767932_955767937 21 Left 955767932 3:62364458-62364480 CCTCAATGATGGAATCAACAAGG No data
Right 955767937 3:62364502-62364524 GTTCTGGGTTGCTTAACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955767937 Original CRISPR GTTCTGGGTTGCTTAACTAA TGG Intergenic