ID: 955769633

View in Genome Browser
Species Human (GRCh38)
Location 3:62374319-62374341
Sequence CTCCTTAAACAGGTGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955769633_955769637 6 Left 955769633 3:62374319-62374341 CCCATCTCCACCTGTTTAAGGAG 0: 1
1: 0
2: 0
3: 8
4: 132
Right 955769637 3:62374348-62374370 GAAACAGCAGAACCTCCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955769633 Original CRISPR CTCCTTAAACAGGTGGAGAT GGG (reversed) Intronic
900652277 1:3735489-3735511 CTCCCTAGACAGGTGCAGCTGGG - Exonic
901840169 1:11949343-11949365 ATCCTCATACAGGTGGAGAATGG + Intronic
902075616 1:13782497-13782519 TTCCTTAAAGAGGAGGAGCTTGG - Exonic
904690638 1:32291259-32291281 CTCTTTAGACAGGAGGAAATGGG - Intergenic
917869721 1:179230013-179230035 CTCATTTGACAGGTGGAGGTGGG - Intergenic
920739271 1:208564767-208564789 CTAATTACACAGGTGGAGCTGGG + Intergenic
920767548 1:208847921-208847943 GTCCGTAAAGAGATGGAGATGGG - Intergenic
922255086 1:223886791-223886813 CAGAGTAAACAGGTGGAGATGGG - Intergenic
923228905 1:231965332-231965354 TTCCTAAAACAGGTGGAAATTGG - Intronic
923251798 1:232185008-232185030 TCCCTTAAACAGGTGGATCTGGG + Intergenic
923931329 1:238701178-238701200 TTCCTTAAAAAGGAGGAGTTTGG + Intergenic
1063707561 10:8445673-8445695 CTCCCTAAACAGGTGAAGAAAGG - Intergenic
1066710413 10:38227492-38227514 CTCCTTTGACAGGTCAAGATTGG - Intergenic
1066979594 10:42399955-42399977 CTCCTTTGACAGGTCAAGATTGG + Intergenic
1069038346 10:63669227-63669249 CTCCTTAAACAGGCTGGGCTGGG - Intergenic
1072038235 10:91583696-91583718 CTCCTTAAAAAGGAAGAGGTTGG + Intergenic
1073703333 10:105955231-105955253 CTCCTTCATCAGGTGGAGTCAGG - Intergenic
1076124823 10:127965802-127965824 CTCCAGAAAGAGGTGGAGACTGG - Intronic
1076408669 10:130230763-130230785 CTCCTTATGCAGGTGGAGGCAGG - Intergenic
1076583335 10:131529683-131529705 CTCCTTGAACCCCTGGAGATGGG - Intergenic
1083893876 11:65610754-65610776 CACCTGAAAAAGGTGGAGAGTGG - Intronic
1084300227 11:68245006-68245028 CTCCCTCAACATGTGGAGAGTGG - Intergenic
1084425140 11:69080344-69080366 CTCCTTAAAATAGTGGAGCTAGG + Intronic
1084704733 11:70809612-70809634 CTCCTCAAACACGTTGACATGGG - Intronic
1085030551 11:73268638-73268660 CTCCTTGGACAGGAGGAGACTGG - Intronic
1085412943 11:76302314-76302336 TTCCTAAAACAAGGGGAGATGGG + Intergenic
1086290417 11:85302591-85302613 TGCCTTACACAGGTGGTGATAGG + Intronic
1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG + Intronic
1087870463 11:103287737-103287759 TTTCTAAAACAGGTAGAGATTGG - Intronic
1087995609 11:104804017-104804039 CACCCTAAACAGGTGCAGTTCGG - Intergenic
1093267383 12:17019563-17019585 CTTCTTACAGAGGTGGACATTGG + Intergenic
1094033935 12:26046796-26046818 CTCCTTAAGCAGGTACACATTGG - Intronic
1098483085 12:70988163-70988185 CTCCTCAGAATGGTGGAGATTGG + Intergenic
1101746913 12:107549154-107549176 TTCCTCAAACAGTTGGTGATTGG - Intronic
1105432781 13:20352251-20352273 TTCCTTAAAGAGGTGGCGAGAGG - Intergenic
1106937519 13:34739513-34739535 CTTTTTAAAAAGGGGGAGATGGG + Intergenic
1106970087 13:35129054-35129076 CTCCTTAAACATGGGGGGAGGGG + Intronic
1107859373 13:44646418-44646440 CTCCTCAAGCAGCTAGAGATAGG - Intergenic
1109220488 13:59636448-59636470 CTACTTCAACAGATGGAGGTTGG + Intergenic
1113906983 13:113823876-113823898 CTCCTGAAACAAGAGGACATCGG - Intronic
1114161956 14:20178187-20178209 CTTCTTAAAAAGATTGAGATAGG - Intergenic
1116757047 14:48961383-48961405 TTCCTAAAACAGGTGCAAATAGG - Intergenic
1117337900 14:54770361-54770383 TTGCTTAAACAGGTGGGGCTGGG + Intronic
1117522068 14:56560796-56560818 CTCATTTCACTGGTGGAGATAGG + Intronic
1118395766 14:65335138-65335160 CTCCTTGAACAGGAGGAGCAAGG - Intergenic
1118508220 14:66440320-66440342 CTTCTAAAACACATGGAGATAGG + Intergenic
1124808393 15:32908900-32908922 CTCCTTACAGAGGAAGAGATGGG - Intronic
1136005772 16:27327661-27327683 GTCCTTAAACACGTGGATTTTGG + Intronic
1138383136 16:56617463-56617485 CTCCTTTTGCAGGCGGAGATGGG - Intergenic
1138404496 16:56778785-56778807 CTCCTGAAGCATTTGGAGATGGG + Intronic
1141520377 16:84574890-84574912 CTCCTCAGAAAGGTGGAGACAGG - Intronic
1142033119 16:87848236-87848258 CTCCTTGAACAGTTACAGATTGG - Intronic
1143057969 17:4176603-4176625 CTCAGTAAAGATGTGGAGATTGG - Intronic
1144007367 17:11113321-11113343 GTCCTTAGAGAGGTAGAGATGGG + Intergenic
1146660058 17:34659700-34659722 CTCCCTGGACAGATGGAGATGGG - Intergenic
1148085558 17:44991814-44991836 CTTCTGAAGCAGGTGGAGCTGGG - Intergenic
1151968301 17:77443890-77443912 CTTCTTAGAAAGGTGGAAATGGG + Intronic
1154016048 18:10618803-10618825 CTCCTGAAACAGGTGGTGGCTGG + Intergenic
1154189465 18:12216841-12216863 CTCCTGAAACAGGTGGTGGCTGG - Intergenic
1155748307 18:29389062-29389084 CTCCTAAAACATTTGCAGATAGG + Intergenic
1156318492 18:35994529-35994551 CTTCATAAGCAGGTGGATATCGG + Intronic
1156783314 18:40878619-40878641 CTGCATAAACAGGTGAAGACAGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158795248 18:60838260-60838282 CTCCTGAAATAGGTGGGGCTTGG - Intergenic
1161585616 19:5103871-5103893 GTCCTTAAGGAGGTGAAGATGGG + Intronic
1161939027 19:7391110-7391132 CTCCTGACACAGGTGGGGAGGGG - Intronic
1162658482 19:12150851-12150873 CTCCATAAACTGGGTGAGATGGG + Intronic
1167491917 19:49797970-49797992 CTCCATAAACAGGTGTAGGGGGG - Intronic
925583294 2:5436502-5436524 ATCCTTTAGCAGGTAGAGATGGG + Intergenic
925723213 2:6847811-6847833 CTCCCTTAACAGCTGGAGGTGGG - Intronic
935005616 2:99073370-99073392 CTCCAAAAACAGGTGGTTATAGG - Intronic
938128648 2:128692428-128692450 CTCTTTAAAAAGATGGAGTTAGG + Intergenic
947701759 2:232240242-232240264 CTCCTGGAGCAGGTGGAGCTAGG - Intronic
948983183 2:241505410-241505432 CACCTTAGACAGGAGTAGATGGG - Intronic
1169293554 20:4373218-4373240 ATTCTTACACAGGTGGACATGGG - Intergenic
1171106755 20:22440847-22440869 CTCCTGAACAAGCTGGAGATTGG + Intergenic
1171801779 20:29627259-29627281 CTCCTTCAACACGTGGGAATGGG + Intergenic
1175658366 20:60791650-60791672 CTCCTTTAGCAGGTGGAGCTGGG + Intergenic
1177969214 21:27767412-27767434 CTACTTAAATAGGTGTAAATAGG - Intergenic
1178200245 21:30395112-30395134 CTCTTTAAAGAGGTGGATTTAGG - Intronic
1183218713 22:36497990-36498012 CTCCTTCAACAGGATGACATCGG + Exonic
1183331619 22:37225291-37225313 CTGCTTAAGCAGGTTGAGTTGGG + Exonic
950733042 3:14979348-14979370 CTCCTTAAACAGTTGCTGAATGG - Intronic
954106771 3:48413808-48413830 CTCCTGACACAGGTGCAGATGGG - Exonic
955769633 3:62374319-62374341 CTCCTTAAACAGGTGGAGATGGG - Intronic
959833889 3:110896048-110896070 GCCCCCAAACAGGTGGAGATAGG + Intergenic
961445275 3:126977691-126977713 CTCCCTACACAGGAGGAGAAGGG - Intergenic
962607909 3:137047898-137047920 CTTCGTAAATTGGTGGAGATTGG + Intergenic
963998073 3:151734696-151734718 CTCCTTTAAAAGGGAGAGATAGG + Intronic
970472078 4:16388937-16388959 CTCCTTCAACAAGAGGATATGGG + Intergenic
976411771 4:84721522-84721544 CTCCTCCATCAGGTGCAGATCGG + Exonic
978233760 4:106432305-106432327 CTCCTTAAACATTTGGAAAGGGG - Intergenic
980583849 4:134788270-134788292 GTTCTTAACCAGGTTGAGATGGG - Intergenic
981927967 4:150160124-150160146 CTACTTAAAGAGGCTGAGATGGG - Intronic
984481296 4:180306377-180306399 CTCCTGAAAGAGGCAGAGATTGG - Intergenic
988010706 5:25479115-25479137 CTCCATGAACAGGTGAAGTTGGG + Intergenic
998196722 5:140079929-140079951 TTCCTTTAAAAGGTGGAGCTTGG + Intergenic
1001418802 5:171571184-171571206 CTCCTTGATCAAGTTGAGATGGG + Intergenic
1001557166 5:172644670-172644692 CTCTTTAAAATGGTGGAGAATGG - Intronic
1001668450 5:173453571-173453593 GCCCTTAAGCAGCTGGAGATGGG - Intergenic
1001703903 5:173728025-173728047 CTCATTAAACAGCTGCAGCTGGG + Intergenic
1003199382 6:3945117-3945139 CTGCTTAGACAGGTGCAGAAAGG + Intergenic
1003463667 6:6356059-6356081 CTCCTAAAACAGGTATAGTTGGG - Intergenic
1003556789 6:7147004-7147026 CTCCAAAAACAGCTGGAGACTGG - Intronic
1003708200 6:8559263-8559285 CTACTTACAAAGGTGTAGATGGG + Intergenic
1003716192 6:8649103-8649125 ATCCTTAAACAGTTAGACATAGG - Intergenic
1003733118 6:8848406-8848428 CTCCAAAAACAGGTGGATCTTGG - Intergenic
1011164856 6:84435048-84435070 CTCCTTTCCCAGGTGGAAATAGG + Intergenic
1014276038 6:119390326-119390348 CTCCATCAAGAGGTGGAGTTTGG + Intergenic
1014774557 6:125493832-125493854 TCCCTCAAACAGGTGGTGATGGG + Intergenic
1017528178 6:155261466-155261488 TTCCTTAAACAGATGAAAATGGG + Intronic
1020360633 7:7323255-7323277 CTCAGTTAACAGGGGGAGATAGG - Intergenic
1024402833 7:48944875-48944897 CTCTTTTAACAGCTTGAGATAGG + Intergenic
1024896751 7:54269387-54269409 CCTCTTAAACAGGTGGTGCTGGG - Intergenic
1027509488 7:79061880-79061902 CACCTTATACATGTGGAGTTTGG + Intronic
1027729289 7:81849453-81849475 CTCCCTTAACATGTGGAGATTGG + Intergenic
1030532608 7:110729484-110729506 CTCCCTCAACACATGGAGATTGG + Intronic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1035561454 8:607356-607378 CTCTTTAAAGAAGAGGAGATGGG + Intergenic
1037124223 8:15325904-15325926 GTCCTTGAGAAGGTGGAGATAGG - Intergenic
1037534334 8:19810808-19810830 CTCATTAATCAGGTGGAAACAGG + Intergenic
1038833470 8:31090856-31090878 CTACATAAACAGGTGGATACTGG - Exonic
1043107747 8:76136266-76136288 CTGCTTAAAAAAGTGGAGAATGG - Intergenic
1046833567 8:118774966-118774988 CACCTTAAGTAGGTAGAGATAGG - Intergenic
1051008725 9:12382962-12382984 CTCCTTAAATAGGTGGATAAAGG + Intergenic
1051137200 9:13935617-13935639 AACATTAAGCAGGTGGAGATGGG - Intergenic
1051977204 9:22965416-22965438 ATCCTAAAACAGATGGAGTTTGG - Intergenic
1052648997 9:31275372-31275394 TTCCTTAAAAAGGTGGGGAGTGG + Intergenic
1054801858 9:69357679-69357701 CTCCTGAAATAGGTTGAGAGTGG + Intronic
1056898095 9:90569859-90569881 GTCCTTCAACAGTTAGAGATAGG - Intergenic
1057326985 9:94074582-94074604 CTCCTCATACAGGTGGAGTTGGG + Intronic
1058842312 9:108921935-108921957 CTCCTTACAAGGGTTGAGATGGG - Intronic
1058910050 9:109512736-109512758 CTCCTTAATCAGGGAGAGACAGG + Intergenic
1060558943 9:124526981-124527003 CTCCTTAAACAGGCTGAGCTTGG + Intronic
1061744358 9:132728651-132728673 CTCCTTGGAGAGGTGGAGGTTGG + Intronic
1190303287 X:49068428-49068450 CTCGTTAAAGAGGTGGAGGCAGG - Intronic
1191845710 X:65546208-65546230 CTCCTTAAATAAGTAGAAATCGG + Intergenic
1193177281 X:78409504-78409526 TTGCTTAAAGAGGTGGAGTTGGG - Intergenic
1194045052 X:88992153-88992175 CTCCCTGAACATTTGGAGATTGG + Intergenic
1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG + Intronic
1197283330 X:124564230-124564252 TTCATTAAAAAGGTGGAGAGGGG - Intronic