ID: 955770287

View in Genome Browser
Species Human (GRCh38)
Location 3:62378476-62378498
Sequence CCGGGAGGGTACCCGAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955770287_955770297 16 Left 955770287 3:62378476-62378498 CCAGGTTTCGGGTACCCTCCCGG No data
Right 955770297 3:62378515-62378537 CCCAGGCCTTTAGGGACAGATGG No data
955770287_955770294 7 Left 955770287 3:62378476-62378498 CCAGGTTTCGGGTACCCTCCCGG No data
Right 955770294 3:62378506-62378528 AAGCACAGTCCCAGGCCTTTAGG No data
955770287_955770295 8 Left 955770287 3:62378476-62378498 CCAGGTTTCGGGTACCCTCCCGG No data
Right 955770295 3:62378507-62378529 AGCACAGTCCCAGGCCTTTAGGG No data
955770287_955770293 -1 Left 955770287 3:62378476-62378498 CCAGGTTTCGGGTACCCTCCCGG No data
Right 955770293 3:62378498-62378520 GAGCACGCAAGCACAGTCCCAGG No data
955770287_955770299 17 Left 955770287 3:62378476-62378498 CCAGGTTTCGGGTACCCTCCCGG No data
Right 955770299 3:62378516-62378538 CCAGGCCTTTAGGGACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955770287 Original CRISPR CCGGGAGGGTACCCGAAACC TGG (reversed) Intergenic
No off target data available for this crispr