ID: 955770350

View in Genome Browser
Species Human (GRCh38)
Location 3:62378745-62378767
Sequence AGACCTGGGCGGGGGCGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955770334_955770350 24 Left 955770334 3:62378698-62378720 CCGTGGAGCAGGAAAGGCGCCTA No data
Right 955770350 3:62378745-62378767 AGACCTGGGCGGGGGCGTAGGGG No data
955770339_955770350 5 Left 955770339 3:62378717-62378739 CCTATTAGCCAGGGGCAACCGGC No data
Right 955770350 3:62378745-62378767 AGACCTGGGCGGGGGCGTAGGGG No data
955770340_955770350 -3 Left 955770340 3:62378725-62378747 CCAGGGGCAACCGGCTTTGCAGA No data
Right 955770350 3:62378745-62378767 AGACCTGGGCGGGGGCGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955770350 Original CRISPR AGACCTGGGCGGGGGCGTAG GGG Intergenic
No off target data available for this crispr