ID: 955775435

View in Genome Browser
Species Human (GRCh38)
Location 3:62427595-62427617
Sequence ACCAGGAATGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 2, 2: 26, 3: 94, 4: 245}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955775428_955775435 -2 Left 955775428 3:62427574-62427596 CCCAACCCCCGAGTTGTAGCAAC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG 0: 1
1: 2
2: 26
3: 94
4: 245
955775431_955775435 -7 Left 955775431 3:62427579-62427601 CCCCCGAGTTGTAGCAACCAGGA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG 0: 1
1: 2
2: 26
3: 94
4: 245
955775432_955775435 -8 Left 955775432 3:62427580-62427602 CCCCGAGTTGTAGCAACCAGGAA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG 0: 1
1: 2
2: 26
3: 94
4: 245
955775424_955775435 28 Left 955775424 3:62427544-62427566 CCTCTGCTTGCTAGATGCCAGTA 0: 3
1: 6
2: 25
3: 206
4: 802
Right 955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG 0: 1
1: 2
2: 26
3: 94
4: 245
955775429_955775435 -3 Left 955775429 3:62427575-62427597 CCAACCCCCGAGTTGTAGCAACC 0: 1
1: 0
2: 2
3: 17
4: 101
Right 955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG 0: 1
1: 2
2: 26
3: 94
4: 245
955775426_955775435 0 Left 955775426 3:62427572-62427594 CCCCCAACCCCCGAGTTGTAGCA 0: 1
1: 0
2: 0
3: 47
4: 909
Right 955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG 0: 1
1: 2
2: 26
3: 94
4: 245
955775425_955775435 11 Left 955775425 3:62427561-62427583 CCAGTAACATGCCCCCAACCCCC 0: 1
1: 0
2: 2
3: 33
4: 297
Right 955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG 0: 1
1: 2
2: 26
3: 94
4: 245
955775433_955775435 -9 Left 955775433 3:62427581-62427603 CCCGAGTTGTAGCAACCAGGAAT 0: 1
1: 0
2: 1
3: 15
4: 185
Right 955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG 0: 1
1: 2
2: 26
3: 94
4: 245
955775434_955775435 -10 Left 955775434 3:62427582-62427604 CCGAGTTGTAGCAACCAGGAATG 0: 1
1: 0
2: 7
3: 67
4: 447
Right 955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG 0: 1
1: 2
2: 26
3: 94
4: 245
955775427_955775435 -1 Left 955775427 3:62427573-62427595 CCCCAACCCCCGAGTTGTAGCAA 0: 1
1: 0
2: 1
3: 10
4: 152
Right 955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG 0: 1
1: 2
2: 26
3: 94
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955775435 Original CRISPR ACCAGGAATGTCTCCAGACA TGG Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901096129 1:6681763-6681785 ACCAAGAGGGTCTCTAGACAGGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
901985711 1:13073916-13073938 GCTTGGAAGGTCTCCAGACAAGG - Exonic
901996098 1:13152851-13152873 GCTTGGAAGGTCTCCAGACAAGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
905167800 1:36093253-36093275 ACCAGCAATGGCCCCAGCCATGG - Exonic
905251540 1:36651973-36651995 ACCACTAATGACTCCAGTCAAGG + Intergenic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905460877 1:38122150-38122172 GCCATGAATGTGTCCAGACTAGG - Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906271717 1:44484515-44484537 ACGTGCTATGTCTCCAGACACGG - Intronic
907239594 1:53074214-53074236 GCCAGGAATGGCTCCACACAGGG - Intronic
907515481 1:54990895-54990917 AGCAGGAATGTGTCCAAGCAGGG + Intronic
908111815 1:60905341-60905363 ACCAGGAATGGCTACATACTTGG - Intronic
909789925 1:79663252-79663274 ACCAGAAATTTATACAGACAGGG - Intergenic
909935383 1:81545007-81545029 ACCAGGGATGTCTCGTGACCTGG - Intronic
910293736 1:85623742-85623764 ACCAAGAATGTGGCCAGGCATGG + Intergenic
910550063 1:88465322-88465344 ACAAGGAATGGCTGCAGTCAAGG + Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912586139 1:110767678-110767700 TCCAGGACTGTCCACAGACATGG - Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
915406557 1:155664433-155664455 ACCAGGAAACTGGCCAGACATGG + Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916493730 1:165326345-165326367 ACTAGGAATGTCTCAAATCAGGG + Intronic
918209855 1:182340974-182340996 CCCAGGAAAGTCTCCTAACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918509032 1:185290052-185290074 CCCAGGAATGAGACCAGACAGGG + Intronic
920707997 1:208268919-208268941 ACCAGCCTTGTCTCCAGACAGGG - Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921158662 1:212457538-212457560 CCCAGGTATCTCTCCAGAGATGG + Intergenic
922570176 1:226629925-226629947 AGGAGGACTGTCCCCAGACACGG + Intergenic
1073600734 10:104843660-104843682 ACCAGGAGTTTCTCAGGACAGGG + Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1075792428 10:125094612-125094634 ACCAGAGATGTCGCCAGATAGGG - Intronic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076803827 10:132845334-132845356 TCCAGAGATGTCTGCAGACATGG - Intronic
1077490021 11:2856767-2856789 AACAGGAAGGTCTCCACAGATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1077631920 11:3816797-3816819 AACAGGAATGTGGTCAGACAGGG + Intronic
1078008184 11:7548276-7548298 CCCAGGAATGGCTTCAGAGATGG - Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079119628 11:17672590-17672612 ACCAGGGCTGCCTCCAGACCAGG + Intergenic
1081496139 11:43612535-43612557 GCCAGGAACTGCTCCAGACAAGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1084966609 11:72747866-72747888 ACCAGCAATGTCACCTGACCAGG + Intronic
1085737618 11:79052871-79052893 AGCAGGAATGCCTCCTGAGAAGG - Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086951711 11:92897555-92897577 ACCAGGAAGAACTCCAGAAAGGG + Intergenic
1087293060 11:96340595-96340617 ACCAGGAGTGGCTGAAGACAAGG + Intronic
1087509225 11:99068999-99069021 ACCATGAATGATGCCAGACAAGG - Intronic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089328560 11:117674281-117674303 GCCAGGCCTGTCTCCAGACTGGG + Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090271766 11:125390975-125390997 ATCAGGAATTTTTCCAGACCAGG - Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1096444431 12:51676241-51676263 CCCAGGAAAGTCTCCAGCAAAGG - Intronic
1098714296 12:73810209-73810231 ACTAGGAATATCTCCAGACCTGG + Intergenic
1099561066 12:84174289-84174311 CCCAGCCATGTCTCCAGACCTGG - Intergenic
1099812286 12:87598943-87598965 ACCAGGAAGTTCTTCAGACCTGG + Intergenic
1100281232 12:93120175-93120197 ATCATGAATGCCTCCAGACAAGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102624291 12:114222205-114222227 ACTAAGAATATCTCCACACATGG - Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1109215414 13:59584185-59584207 TCAAGGAGTGTCTACAGACAGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1113679051 13:112229630-112229652 ACCAGGAAGGACTCCAGAGAGGG + Intergenic
1113948225 13:114056886-114056908 CCCAGGAATTTCTCCAGCAATGG + Intronic
1114386836 14:22264232-22264254 ACCAGGAATGTCCTCAAAGAAGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121640188 14:95480166-95480188 CCCAGGGATGTCCCCAGACAGGG - Intergenic
1123886412 15:24732036-24732058 ACCAGGACTGGATACAGACAGGG + Intergenic
1124603550 15:31153612-31153634 ACCTGGAATCTGGCCAGACACGG - Intronic
1126475431 15:49061017-49061039 AGCAGGAATGTTTTCAGAGATGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130534303 15:84772339-84772361 ACCAGGAATGGAAGCAGACAAGG - Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131357382 15:91757588-91757610 CCCAGGAATGGCTGCAGAGACGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132547707 16:540877-540899 ACCTGGACTGCCTCCAGACCAGG - Intronic
1133071546 16:3249763-3249785 CCCAGGAAGGCCACCAGACACGG - Exonic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133661675 16:7924293-7924315 ACCACCACTATCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1137663430 16:50230324-50230346 AACAGGAATGAGACCAGACATGG - Exonic
1138623162 16:58227771-58227793 ACCAGGAATGTTTGGAGAAATGG + Intergenic
1138661440 16:58520559-58520581 ACCAGGAATGTCAGAAGACATGG + Exonic
1138774607 16:59706408-59706430 CCTAGGTATGTCTCCAGAGAGGG - Intergenic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141238909 16:82246505-82246527 AGCAGGAAGGTCTCAAGCCAAGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1142482514 17:227623-227645 ACCAGGGCTGTCTCCACCCATGG - Intronic
1143662274 17:8333063-8333085 ACCAGGGCTGTCTCCAGACTAGG + Intergenic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144288968 17:13807216-13807238 ACCAGGGCTTTCTCCAGACATGG - Intergenic
1144662544 17:17080555-17080577 ATCAAGGATGACTCCAGACATGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146009431 17:29181376-29181398 AACAGGAACTTCTCCAGGCAAGG + Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1146734784 17:35229252-35229274 ACCAGCCATGGCACCAGACATGG - Intergenic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1148601088 17:48894791-48894813 TCAAGGAATGTTCCCAGACAGGG + Intronic
1150201032 17:63357799-63357821 AGCAGGACTCTCTCCAGGCATGG + Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1151595313 17:75074820-75074842 ACCAGCAACGTCTGCAGGCAAGG + Intergenic
1151731008 17:75911062-75911084 ACAAGGAATGTTTACAGACAAGG - Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1154010054 18:10566637-10566659 AGCAGGACTGCCTTCAGACAGGG + Intergenic
1154286467 18:13061850-13061872 ACCAGTAACGTCTCCAAACATGG + Intronic
1155168659 18:23250722-23250744 ATCAGGAAGGTCTCCTGACCTGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161248199 19:3266733-3266755 CCCAGGAATGCCTGCAGAAATGG + Intronic
1161314196 19:3610310-3610332 ACCACGAATGCCCCCAGGCATGG + Intergenic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161827057 19:6575032-6575054 ACAATGAATGACTCCAGCCATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162763009 19:12899574-12899596 GCCAGGCATCTCTCCAGAAAGGG - Exonic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166428765 19:42703994-42704016 ACTAGGAATGTATCTAAACAAGG - Intronic
1167001493 19:46747793-46747815 AGCATGAATGTGTCCAGAAAAGG - Intronic
1167138599 19:47633655-47633677 ACCTGGAAGCTCTCCAGAAATGG - Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
925574227 2:5343937-5343959 ACCAGTATTGTCTCCACAGATGG - Intergenic
929283792 2:40113284-40113306 GCTAGGAATGTCTCCAGCCTGGG + Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
934855281 2:97725434-97725456 ACTAGGAAAGCCTCCAGACTCGG + Intronic
935260631 2:101352792-101352814 ACCTGGACTGTCTCCAAAAAAGG + Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937126549 2:119478450-119478472 ACCAGGAGGGGTTCCAGACATGG + Intronic
937240947 2:120462333-120462355 ACCTTGAATGCCTCCAGAGATGG + Intergenic
937454602 2:122030563-122030585 TCCTGGAAGGTCTCCAGAGAAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938255358 2:129855168-129855190 ACCAGGGATGTGTGCACACAAGG - Intergenic
938688406 2:133763382-133763404 TCCAGGCCTGTCTCCTGACAAGG + Intergenic
939294751 2:140246093-140246115 AACAGGAATGTCAGCAGAGATGG + Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
942926371 2:181437940-181437962 ACCATGACAGTATCCAGACAGGG + Intergenic
945939452 2:215933506-215933528 GCTAAGAATGTCTCCAGATATGG + Intergenic
946109248 2:217399507-217399529 ACCAGGAATTTCTCCTGACTGGG - Intronic
947635317 2:231677750-231677772 AACAGGAAGGTGGCCAGACAAGG - Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947868066 2:233415166-233415188 AACAGCCATGTCTCCTGACAAGG - Intronic
1169799203 20:9497849-9497871 CCCAGGTATGTCTCCAGTGAAGG - Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173405282 20:42759048-42759070 ACCAGGAATGTATCCTGATTTGG + Intronic
1174502771 20:50997673-50997695 CCCATGACAGTCTCCAGACAGGG + Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175299678 20:57934117-57934139 ACCAGGAAGGTGTCCAGGAATGG + Intergenic
1175641783 20:60636193-60636215 ACCTGAAATGTCACCATACATGG - Intergenic
1175837608 20:62006237-62006259 ACCAGTAACATCCCCAGACAAGG + Intronic
1175857988 20:62133084-62133106 ACCAGGACTGTCTCCACAGTGGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181887344 22:26031780-26031802 GGCAGGAAGGTCTCCAGAGACGG - Intergenic
1182900533 22:33894677-33894699 ACCAGATATGGGTCCAGACAAGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
949923888 3:9025471-9025493 CCTATGAATGTCTCCAGAAATGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955648507 3:61166997-61167019 CCAGGGAATGACTCCAGACAGGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
955778902 3:62462859-62462881 GGCAGGAATATCTCCACACATGG - Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956087947 3:65633248-65633270 ACCACACATGACTCCAGACACGG + Intronic
960198481 3:114800801-114800823 AGCAAGAATCTTTCCAGACAGGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962491969 3:135903240-135903262 AGTGGGGATGTCTCCAGACATGG + Intergenic
963237512 3:142970336-142970358 CCCAGTACTGTCTCCAGACAGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964256980 3:154786584-154786606 ACCAGGAAAGTCTCAAAGCAGGG - Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
965803931 3:172523151-172523173 AGCAGGAAAGTCTTCAGAGAGGG + Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967984597 3:195085645-195085667 ACTAGGATTGTCACCAGACACGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
969896645 4:10311606-10311628 GCCTGGCATGTCTCCACACACGG - Intergenic
975818577 4:78245939-78245961 ACCAGAAATCTTTGCAGACATGG + Intronic
976180229 4:82391917-82391939 ACCAGAAAGCTCTCCAGTCATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976824764 4:89248769-89248791 AGCAGGAATGACTCCAGTGAGGG - Exonic
978207625 4:106097422-106097444 AGCATGAATGTCTGTAGACATGG + Intronic
978343185 4:107738875-107738897 GGCTAGAATGTCTCCAGACAAGG + Intergenic
981689241 4:147488318-147488340 ATCTGGAATGTCTCCAGATTTGG + Intronic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984385699 4:179054506-179054528 ACCAAGATTGTCTTCAGAGAGGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985118058 4:186611504-186611526 AACAAGAATGTCCTCAGACACGG + Exonic
985915862 5:2918751-2918773 AGCAGGAATGTCTGGAGACGTGG - Intergenic
986596636 5:9429607-9429629 ATCAGGAATATCTCCTGACAAGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987086674 5:14476323-14476345 ACCAGGAAGGTCACCAGCCAAGG + Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989652584 5:43709612-43709634 CTCAGGAATGTCTACAGTCAGGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
991903625 5:71485655-71485677 TCCAGGAATGAATCCAGACCAGG - Intronic
992093574 5:73340173-73340195 CCAAGGAATGTCTGCAGCCAAGG - Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998338140 5:141392693-141392715 ACCTGGAGTGCCTCCAAACAGGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001708917 5:173762363-173762385 TCCAGGAATGGCTGCAGATAAGG + Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002545428 5:179940101-179940123 ACCAGGCATGTCTGCACACCTGG + Intronic
1003877489 6:10451373-10451395 ACCCAGAAGGTCTCCAAACATGG - Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1011810579 6:91128130-91128152 ACCATGAATGTCACCTTACATGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1019278725 7:189236-189258 CCCAGGAAGGCCTCCAGGCATGG - Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1023760623 7:43462249-43462271 TCCAGGAAAGTCTCCAGCCTAGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028759144 7:94475552-94475574 GGCAGGAATGTCTGCAGACAAGG + Intergenic
1028874555 7:95806514-95806536 ACCAGGAATGTCTAGAGTCCAGG - Intronic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031361385 7:120852938-120852960 GCCAGGAATGTCTCCAGCACAGG + Intronic
1031515279 7:122691830-122691852 CCCCAGAATGTCTCCAGGCATGG + Intronic
1031680634 7:124669348-124669370 AGTAGGAATGTATCCAGATAAGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032348736 7:131140575-131140597 ACCAGGCATGTCACATGACATGG - Intronic
1032986402 7:137342844-137342866 CCCAGGAATGGTTCCAGAAATGG - Intronic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037938668 8:22932712-22932734 AATAGGAATTTTTCCAGACACGG + Intronic
1038069743 8:24000861-24000883 AAGAGGAAGGTCTACAGACATGG - Intergenic
1038620410 8:29137429-29137451 CCCAGGAATGTCTGCAGGCACGG + Intronic
1038710666 8:29941374-29941396 ACCAGGAATCTGTCCACCCAAGG + Intergenic
1039059859 8:33565062-33565084 AGCAGGAATGACGTCAGACAAGG + Intronic
1040412489 8:47168510-47168532 AGCAAGAATGTCTCCATCCAAGG - Intergenic
1042027593 8:64440437-64440459 TCCTGGAAGGTCTCCAGATATGG + Intergenic
1042950158 8:74192819-74192841 GCCTGGAATGTTTCCAGATAAGG - Intergenic
1045583485 8:103501908-103501930 ACCAGGGAACTGTCCAGACAGGG + Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046137725 8:110051607-110051629 ACCGGGACTGTCTCCAGCAAAGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048906526 8:139094530-139094552 ACCTGGAATGTCTTAACACATGG - Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056296774 9:85201139-85201161 CCCAGGAATATTTCCTGACATGG - Intergenic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1056911960 9:90709208-90709230 ACAAGGCATGTCTTCAGAGAAGG + Intergenic
1056923275 9:90810583-90810605 ACCAGGGAGCTCTCCAGATATGG + Intronic
1057009480 9:91589138-91589160 ACCAGGAATCAGTCCAGCCAGGG + Intronic
1057422447 9:94923274-94923296 CCCAGGACTGGCACCAGACAGGG - Intronic
1057547803 9:96031222-96031244 AACAGAAATATTTCCAGACAGGG + Intergenic
1058584993 9:106498113-106498135 AGAAGCAATGTCTCCAGGCAAGG + Intergenic
1058902657 9:109455943-109455965 CCCAGGAATGAGTCCACACAAGG - Intronic
1059233586 9:112743384-112743406 AACCGGAATGTCTCCACTCATGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1060954495 9:127629016-127629038 AGCAGGAATGTGCCCTGACAGGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061702474 9:132426434-132426456 AACAGTAATGTCTTCAAACAGGG + Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1061848379 9:133400700-133400722 ACCAGGAGTGTCTCCTGGCCTGG - Intronic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186256117 X:7721907-7721929 ATCAGGGATGCCTCCAGATATGG + Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1187143795 X:16619426-16619448 AAGAGGCATCTCTCCAGACAGGG - Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188673209 X:32905873-32905895 ACTAGGAATCTCTCCGGACATGG + Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189157579 X:38774324-38774346 ACCAGGAGTGTGGACAGACAGGG + Intergenic
1193985699 X:88238048-88238070 ACCAGGGAAGACTCCAGACAGGG - Intergenic
1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG + Intergenic
1194775197 X:97954576-97954598 ATCAGTAATGTCTCTAGCCATGG + Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195929070 X:110055301-110055323 ACTAGGAATGTTTCCAAGCAGGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1198398072 X:136243048-136243070 ATCAGGAAGCTCTCCAGATAGGG + Intronic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1200750686 Y:6941693-6941715 ACCAAGAAATACTCCAGACAAGG - Intronic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic