ID: 955777237

View in Genome Browser
Species Human (GRCh38)
Location 3:62446981-62447003
Sequence GTCTCCCAGAAAAGTACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955777231_955777237 28 Left 955777231 3:62446930-62446952 CCTCCTGCAATTTGGCTGAGATC 0: 1
1: 0
2: 1
3: 9
4: 129
Right 955777237 3:62446981-62447003 GTCTCCCAGAAAAGTACCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
955777232_955777237 25 Left 955777232 3:62446933-62446955 CCTGCAATTTGGCTGAGATCAAT 0: 1
1: 0
2: 0
3: 17
4: 124
Right 955777237 3:62446981-62447003 GTCTCCCAGAAAAGTACCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955777237 Original CRISPR GTCTCCCAGAAAAGTACCCA GGG Intronic
902292223 1:15442773-15442795 GACTCCCAGGAAAGTCCACAAGG + Intronic
905915086 1:41679006-41679028 GTGTCCCAGTACAGGACCCATGG + Intronic
909748776 1:79133555-79133577 GTCTCCCAGGAAAGAATTCAAGG + Intergenic
911885372 1:103290980-103291002 GTCTCCCAGCCCAGTACACAGGG + Intergenic
912122234 1:106485773-106485795 TTATCCCAGAAAAGTTCCCAAGG - Intergenic
916334839 1:163659205-163659227 GACTCACAGAAAAGTGCCCCAGG - Intergenic
916828032 1:168462593-168462615 GTCTCTCAGACAACTGCCCAAGG + Intergenic
922243364 1:223771671-223771693 GTCTCACAGAAGAGCAGCCAAGG + Intronic
1064500675 10:15969484-15969506 GTCTCAAGAAAAAGTACCCAAGG + Intergenic
1064586999 10:16849325-16849347 AGCTCCAGGAAAAGTACCCAGGG - Intronic
1065381179 10:25091998-25092020 GTCTCCCAGGAAAGAACACCTGG - Intergenic
1068563770 10:58547930-58547952 GTCTCCAATAAAAGAAACCAGGG - Intronic
1068962034 10:62876807-62876829 TTCTCTAAGAAAAGTGCCCAGGG - Intronic
1069589165 10:69631100-69631122 GACTCCCAGTTTAGTACCCAGGG + Intronic
1078571710 11:12464077-12464099 TTCTCCAATAAAAGTAACCAGGG - Intronic
1080639605 11:34151155-34151177 GTCACCCTGAAAAGCCCCCAGGG - Exonic
1081256386 11:40901563-40901585 TTCTCCCAGAAAATTACTGATGG + Intronic
1081716367 11:45253211-45253233 GCCAGTCAGAAAAGTACCCAAGG - Intronic
1084185373 11:67468452-67468474 GTCTCCAAGAAAAGCAGCCTAGG + Intronic
1085270238 11:75265891-75265913 GTCTCCCAGAAAAGCTGCCAGGG - Exonic
1085626365 11:78076748-78076770 GTCTCCCAGAAAGGCACAAACGG + Intronic
1094031544 12:26017609-26017631 GTCTACCAAAAACGCACCCAAGG + Intronic
1099141996 12:78989629-78989651 ATCTTCCAGAAAACTACCAATGG + Intronic
1101520519 12:105478236-105478258 TTCTCCCAGGACATTACCCATGG - Intergenic
1110972252 13:81779901-81779923 GCCTCCCAGAAAAGTAGCAGAGG - Intergenic
1113986997 13:114325241-114325263 GAGTCCCAGAAAAGTTCCCGTGG + Exonic
1115630787 14:35243144-35243166 GTTTCCAACAAAAGTACCTAAGG + Intronic
1121510414 14:94509085-94509107 GTCTACCAGAAAGCTATCCATGG - Intronic
1122773688 14:104108002-104108024 CCCTCCCCGAAAAGAACCCAGGG - Intronic
1127744405 15:61951666-61951688 GTCCCCTAGAACTGTACCCAGGG + Intronic
1128620285 15:69143317-69143339 GTCTCCTAGAAACCAACCCAAGG + Intergenic
1129102352 15:73277767-73277789 TTCTCCTAGAAAAGCAACCAAGG - Intronic
1131381514 15:91968073-91968095 GTCGCCCTGGAAAGTACCCAGGG + Intronic
1132205811 15:99985338-99985360 GTGTCCCAGAAAAGGGCCCCAGG + Intronic
1132302500 15:100784648-100784670 GCCTGCCAGAAAAGTACCTGGGG - Intergenic
1135224123 16:20640759-20640781 GTCTGCCAGAATAGTTCGCAGGG - Intronic
1135298764 16:21306165-21306187 TTTTCCCACAAAAGTACCAAGGG - Intergenic
1136403348 16:30030221-30030243 GTCTCCCAGAACAGTGAGCAAGG + Intronic
1141748908 16:85945273-85945295 GACTTCCAGAAAAGTTTCCACGG - Intergenic
1142582655 17:951792-951814 CTCTCCCAGGGAAATACCCACGG - Intronic
1144552759 17:16255864-16255886 GTTTCCTAGAAAAGAAACCAGGG + Intronic
1148582588 17:48753945-48753967 GTGTCCCAGAAAAAAACCCTCGG + Intergenic
1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG + Intergenic
1149601162 17:57893757-57893779 GTGGTCCAGAGAAGTACCCAAGG - Intronic
1149998545 17:61417547-61417569 CTCTCCCAGCAAGGTCCCCAGGG - Intergenic
1150273412 17:63881194-63881216 GGTTCCCAGAAAAGTAACAATGG - Intronic
1150279018 17:63918182-63918204 GGTTCCCAGAAAAGTAACAATGG - Intronic
1151255811 17:72875567-72875589 ATCTCCCACAAAGGCACCCATGG + Intronic
1153669136 18:7393628-7393650 GTCTCCCAGACACCTTCCCAGGG + Intergenic
1154026610 18:10713682-10713704 CTCTCCCAGAATAGAGCCCAGGG + Intronic
1157932312 18:51836479-51836501 GCCTGCCACAAAAGTACCTAAGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1161702232 19:5801975-5801997 CTATCCCAGAAAGGAACCCAGGG - Intergenic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1164371305 19:27646705-27646727 GTCTCCCATAAAAATGCCTAGGG + Intergenic
1168491939 19:56818256-56818278 GTCTTCCAGGAAAGTCCACATGG + Intronic
925161070 2:1684889-1684911 GTCTCCCAGCAGAGCACCCCAGG - Intronic
926239959 2:11077868-11077890 CTCTCCCACAACACTACCCAGGG + Intergenic
936913307 2:117614759-117614781 GTCTCAGAGACAAGAACCCATGG + Intergenic
936922476 2:117703007-117703029 GTTTCCCAGAAAAATCCCCGAGG + Intergenic
936936954 2:117847981-117848003 ATTTCCCAGAAAGGGACCCAGGG + Intergenic
941544194 2:166827069-166827091 TTCTCCAAGAAAAGGAACCAGGG + Intergenic
944297737 2:198085997-198086019 GTCACCCACAAAAGAACGCAGGG - Exonic
946051736 2:216868604-216868626 GTCTACCAGAGAGGTCCCCAAGG + Intergenic
1168859366 20:1035026-1035048 GTCTTCAAGAAAAGAATCCAGGG - Intergenic
1170803041 20:19606151-19606173 CTCTCCCTGAAAATTACCCAGGG + Intronic
1172408778 20:34707481-34707503 TTTTCCCAGAAAAATACACATGG + Intronic
1173553182 20:43947644-43947666 CTCTCCCAGTCAAGAACCCATGG - Intronic
1175673222 20:60924211-60924233 CTCTCCAATAAAAGTAACCAGGG - Intergenic
1178774791 21:35539682-35539704 GTATCCCAGAATTGTACCCAAGG + Intronic
1182718386 22:32377961-32377983 GTCTCTGAGAAAATCACCCATGG - Intronic
1184251234 22:43261477-43261499 GTCTCCTAGAATAGTCACCAAGG - Intronic
949868916 3:8570434-8570456 ATCTCCCACAACAGTCCCCATGG + Intergenic
950251143 3:11466507-11466529 GCCTTCCAGAAGAGTCCCCAAGG - Intronic
950744755 3:15078530-15078552 TTCTCGCTCAAAAGTACCCAAGG + Intronic
951099168 3:18666952-18666974 GTCTCCCACCCAAGTATCCAGGG + Intergenic
952330643 3:32361574-32361596 GTCTCCCAGACAAGTTCCCAGGG - Intronic
954770638 3:52964980-52965002 CTCTCCCATAAAAGAACCAAAGG + Intronic
955777237 3:62446981-62447003 GTCTCCCAGAAAAGTACCCAGGG + Intronic
956039610 3:65132205-65132227 AATTCCTAGAAAAGTACCCAGGG + Intergenic
956039832 3:65134077-65134099 AATTCCTAGAAAAGTACCCAGGG + Intergenic
960470227 3:118055267-118055289 GTCTGCCAGGAAAGTAAGCAAGG - Intergenic
961913246 3:130343085-130343107 GTGTCTCAGAAAGGAACCCAGGG + Intergenic
970213246 4:13732676-13732698 GTTTTACAGAAAAATACCCAGGG + Intergenic
970384996 4:15546982-15547004 TTCTCCCATTATAGTACCCATGG - Intronic
972633625 4:40863267-40863289 GACCCTCAGAAATGTACCCATGG - Intronic
973828065 4:54729258-54729280 GCCTCCCATAAAAATACCCAAGG - Intronic
974407758 4:61497412-61497434 GTCTCAGAGAAAAGATCCCAAGG - Intronic
976214602 4:82704464-82704486 GTACCCAAGGAAAGTACCCAAGG + Intronic
976892155 4:90062756-90062778 GTCTCCCAGAAAATTCTCAAAGG + Intergenic
978614810 4:110583976-110583998 TTCTCCCATAAAAGAAACCAGGG + Intergenic
979241514 4:118451127-118451149 CTCTACCACAAAACTACCCATGG + Intergenic
982756179 4:159221184-159221206 CTCTCACAGAAAAGGACCCTGGG + Intronic
985323216 4:188737828-188737850 GTCACCCAGAAAAGCAACCCTGG - Intergenic
994681176 5:102889298-102889320 GCCTACCAGAAAAGGAACCAAGG - Intronic
994902612 5:105795275-105795297 GTGTTCCAGAAAAGGGCCCAGGG + Intergenic
999281931 5:150371833-150371855 ATTTTCCAGAAAAGTACACAAGG - Intronic
1000166688 5:158656493-158656515 GCACCCCAGGAAAGTACCCATGG - Intergenic
1002054189 5:176589401-176589423 GGCTTCCAGGAAAGGACCCAAGG - Exonic
1004868476 6:19878087-19878109 GTCTCCAATAAAAGGAACCAGGG + Intergenic
1006526682 6:34612003-34612025 ATGTCCCAGAGAAGTAGCCAAGG + Intronic
1009373239 6:62934815-62934837 GTCTCCCAGAAAAGAAAACCTGG - Intergenic
1010334917 6:74669423-74669445 TTTTCCCAGAAAAGTTTCCAAGG - Intergenic
1017242963 6:152191409-152191431 GTCTCCCAGCAAAGAAGCCCAGG - Intronic
1017745783 6:157445882-157445904 TTCTCCCAGCAAATTATCCAGGG + Intronic
1020528399 7:9295153-9295175 GTCTCCCAGTCAAGTGACCATGG - Intergenic
1021860408 7:24900520-24900542 CTTTCCCAGAAAAGAACTCAGGG - Intronic
1023221805 7:37927108-37927130 TTCTCCAGGAAAAGTAACCAGGG - Intronic
1024039757 7:45542954-45542976 GTCTCAGAGAAAAGTCCCCATGG + Intergenic
1028018018 7:85739221-85739243 GTCTCCCAGTAGAGCACACATGG - Intergenic
1032271817 7:130415528-130415550 ATCTCCCAGAACAATACCCTTGG - Intronic
1037650211 8:20829597-20829619 AGCTCCCAGCAAAGTCCCCAGGG - Intergenic
1039448832 8:37654835-37654857 GTCTCCTCAAAAAGTTCCCAGGG - Intergenic
1044071103 8:87760926-87760948 GTTTCCCACATAAGTACTCAGGG + Intergenic
1045239075 8:100382791-100382813 GTTTCCATGAAAAGAACCCATGG + Intronic
1048857446 8:138696877-138696899 TCCTCCTAGAAAACTACCCATGG + Intronic
1049205110 8:141360039-141360061 CTGTCCCAGAAAACTCCCCAGGG + Intronic
1049253540 8:141602045-141602067 TTCACCCAGGAAAGAACCCAAGG - Intergenic
1049510575 8:143024859-143024881 GTGTCCCAGCAAATTCCCCAGGG - Intergenic
1052511107 9:29421769-29421791 GTCTCCCAGAAGAGTGACCTTGG - Intergenic
1052980290 9:34443488-34443510 CTCTCCCACAAAAGTTCCCTTGG + Intronic
1061391747 9:130320716-130320738 GTCCCCCAGACAACCACCCAGGG + Intronic
1061509965 9:131054376-131054398 GCCTCCCAAAACATTACCCATGG - Intronic
1193245867 X:79228620-79228642 GTCTCCCAGCAAAGTAAGCCTGG - Intergenic
1193509527 X:82382649-82382671 GTATCCCAGAATAATATCCAGGG - Intergenic
1195092059 X:101470092-101470114 TTCTCCCAGAAAAGAATTCAAGG - Intronic
1198768452 X:140102730-140102752 GTCTCTCAGAATGGTACCAAGGG - Intergenic
1200138959 X:153888064-153888086 CTCTCCCAGTGAGGTACCCAAGG + Intronic
1201486686 Y:14502307-14502329 TTCTCCAATAAAAGAACCCAGGG - Intergenic
1202389231 Y:24352957-24352979 CTCTACCACAAAATTACCCATGG + Intergenic
1202481556 Y:25317167-25317189 CTCTACCACAAAATTACCCATGG - Intergenic