ID: 955777525

View in Genome Browser
Species Human (GRCh38)
Location 3:62449575-62449597
Sequence TTCCAAAACTCTAGTGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955777525_955777530 8 Left 955777525 3:62449575-62449597 CCCAACCCACTAGAGTTTTGGAA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 955777530 3:62449606-62449628 AGAAAATCCAAGCATGCACCAGG 0: 1
1: 0
2: 3
3: 8
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955777525 Original CRISPR TTCCAAAACTCTAGTGGGTT GGG (reversed) Intronic
904868525 1:33601646-33601668 TTCCAAAGATCCAGTGGTTTGGG + Intronic
909347278 1:74605591-74605613 TTTCAATACTGTTGTGGGTTAGG + Intronic
909798782 1:79779361-79779383 ATCCAAAAGTCTAGTTAGTTAGG + Intergenic
911616101 1:100013186-100013208 TTAAAAAACTTTATTGGGTTTGG + Intronic
913056514 1:115166578-115166600 CTGCAAAACTCTAGTGGCCTTGG + Intergenic
917059875 1:171025816-171025838 TTTTAAAACTTTAGTGGGTTTGG - Intronic
919491578 1:198212061-198212083 TTCCCAGACTCCAGTGGGATGGG + Intronic
920717376 1:208353010-208353032 GTCCAAATGTCGAGTGGGTTGGG + Intergenic
923557930 1:235015737-235015759 TTCCAAAATACAAGTGGGTGGGG + Intergenic
924704190 1:246485719-246485741 GTCCAAAGCTGTAGTGGGCTAGG + Intronic
1066758259 10:38731141-38731163 TTCCTACACTCTAACGGGTTTGG - Intergenic
1068587999 10:58821828-58821850 TTCCAAACCTCTCTTGGCTTTGG + Intronic
1071617670 10:87091448-87091470 TTCAAAAGTTCTGGTGGGTTTGG - Intronic
1073550930 10:104400496-104400518 TTCAAAAACTCTAATGGGAGGGG + Intronic
1073730706 10:106284348-106284370 TTCCAAAACTCCACTGCCTTTGG - Intergenic
1075636201 10:124032201-124032223 TTCCAAGACTCCAGGGGTTTGGG + Intronic
1077462974 11:2720123-2720145 TTGCAACCCTCCAGTGGGTTTGG - Intronic
1078508044 11:11966554-11966576 TTTCAAAACCCTAGTGGGGGCGG + Intronic
1081142905 11:39525179-39525201 TACAAAAACTCTAGTGAGCTGGG - Intergenic
1082073698 11:47960256-47960278 TTCAAAAACTCTTTTGGGTCGGG + Intergenic
1083915762 11:65742720-65742742 TTGAATAACTCTGGTGGGTTTGG + Intergenic
1083925519 11:65803816-65803838 TTCCAGAGCTCCTGTGGGTTTGG - Intergenic
1090561138 11:127934143-127934165 TACAAAAACTCTGGTGGTTTTGG - Intergenic
1092605401 12:10112635-10112657 TTCCAGAACTCTAGTTATTTAGG + Intergenic
1092819786 12:12342530-12342552 TTCTAGAACTCTAATGGGATGGG - Intronic
1097035103 12:56118675-56118697 TTCGCAAACTCTAGGGTGTTGGG + Intronic
1099081670 12:78191156-78191178 TTTCAAGAATCTAATGGGTTTGG - Intronic
1109240447 13:59880306-59880328 TCCCAAATCCCTAGTGTGTTTGG - Intronic
1110525861 13:76536244-76536266 ATCCAAAACTCTGGTGGGGCAGG - Intergenic
1110668673 13:78149521-78149543 TTCCATATCTCTAGTGGTCTGGG + Intergenic
1111272413 13:85904024-85904046 ATCCAAACCTCCAGTGTGTTTGG + Intergenic
1111915632 13:94357255-94357277 TTCCAAACCCTTAGTGGGTTTGG + Intronic
1120948173 14:90017253-90017275 TTTCCAAACTCTTGTGGGGTTGG - Intronic
1121786628 14:96666357-96666379 TTCCCCCACTGTAGTGGGTTTGG - Intergenic
1127557724 15:60104548-60104570 TTCCAAAAGTCTATGGGGTTGGG + Intergenic
1129977938 15:79838164-79838186 TTCCCAAACCCCAGTGGGTTAGG - Intronic
1130682068 15:86005664-86005686 TTCAAAAAGTCTAGTTGGTAGGG + Intergenic
1131438163 15:92439408-92439430 TTCCATGACTGTAGTGGGTTGGG - Intronic
1135068261 16:19329932-19329954 TTGCAAACCATTAGTGGGTTGGG - Intergenic
1135091620 16:19522229-19522251 TTCCAAATCTAAGGTGGGTTAGG + Intergenic
1143241888 17:5450601-5450623 TTCCAAATTTCTTGTGGGTAGGG + Intronic
1148973630 17:51507309-51507331 TTCCAAATCTTGGGTGGGTTGGG + Intergenic
1152805854 17:82355971-82355993 CTCCAAAACCCAAGTGGGCTTGG - Intergenic
1158513948 18:58115554-58115576 TTCCAGAACTCTGGTGGGGAAGG + Intronic
1158626824 18:59078766-59078788 TTCCAAGAATGGAGTGGGTTGGG - Intergenic
1162008415 19:7795223-7795245 TTCCAAATCTGTACGGGGTTTGG + Intergenic
1162707009 19:12562673-12562695 TGACAAACCTCTAGTGGGATGGG - Intronic
927918407 2:26951451-26951473 TGCCAAAAATCCATTGGGTTTGG + Intergenic
928145049 2:28766129-28766151 TTCTAAAACTCTTCTGTGTTTGG + Intronic
929982845 2:46698206-46698228 TTCTAAAACACTAGTGGGGCCGG + Intergenic
931923098 2:67042179-67042201 TTCCAAAACTCTTGTGGAGAGGG - Intergenic
932887139 2:75558706-75558728 TACCAAAAGAATAGTGGGTTGGG + Intronic
933629912 2:84644270-84644292 TGACAAAACTCTAGCAGGTTAGG + Intronic
934321577 2:91975581-91975603 TTCCTACACTCTAACGGGTTTGG - Intergenic
936803483 2:116295408-116295430 TTTCAAAACTCTAGGAGATTTGG + Intergenic
941222583 2:162802258-162802280 TTCCAATACTCAAATGGGCTGGG + Intronic
943225952 2:185176446-185176468 TTCCAAAGCTCAAGTGGTTTGGG + Intergenic
944384738 2:199151703-199151725 TTCCAAAAACCTAGTGGATGGGG - Intergenic
944384866 2:199152904-199152926 TTCCAAAAATCTAGTGGATGGGG - Intergenic
1173937945 20:46884009-46884031 TGCCAAAACCCCAGTTGGTTTGG - Intergenic
1174560433 20:51427180-51427202 TTCAAAACCTGTGGTGGGTTTGG + Intronic
1174739396 20:52997610-52997632 TTCAGAAACTCTAGAGGGTAGGG - Intronic
1178615654 21:34130555-34130577 TTTCAGATCTCTAGAGGGTTTGG + Intronic
1180042167 21:45286439-45286461 TTGCAAATCTCTTTTGGGTTTGG + Intronic
1181115152 22:20627985-20628007 ATCCAAAATTCCAGTAGGTTTGG + Intergenic
1182137137 22:27916903-27916925 TTCTAAAATTCTTGTTGGTTAGG - Intronic
950654064 3:14425744-14425766 TTCCAAAAATGGTGTGGGTTGGG + Intronic
952085230 3:29812509-29812531 TTCCCAAAATCTAGAGGGTCAGG + Intronic
955777525 3:62449575-62449597 TTCCAAAACTCTAGTGGGTTGGG - Intronic
958428912 3:94014225-94014247 TTCTGAAATTTTAGTGGGTTAGG + Intronic
958747561 3:98155233-98155255 TTCCAAAAATCCAGAGGGTAGGG - Intergenic
959568132 3:107853454-107853476 TTCCAAATACCTAGTGGATTAGG - Intergenic
961742552 3:129041894-129041916 TAATAAAACCCTAGTGGGTTAGG - Intergenic
962430377 3:135313346-135313368 TTCCAACACTCTTTTGGGCTGGG - Intergenic
963236441 3:142962025-142962047 TTCAAAGCCTCCAGTGGGTTGGG + Exonic
965269743 3:166599932-166599954 TTATAAAATTCTAGTGGATTAGG - Intergenic
967929902 3:194683350-194683372 TTCCAAGGCTCAAGAGGGTTTGG - Intergenic
972795751 4:42417510-42417532 TTGCAACATTTTAGTGGGTTTGG - Intronic
975071785 4:70149465-70149487 TTACAAAACCCTAGTGCCTTTGG + Intronic
987964050 5:24849421-24849443 TTGCAAGACTATAGAGGGTTGGG + Intergenic
992220938 5:74572816-74572838 TGTCAAAACTCTAGTAGGTCTGG + Intergenic
993058903 5:83015532-83015554 TTGGAAAAATCTAGTGGGGTTGG + Intergenic
993333025 5:86623210-86623232 TTCCAGTATTCTAGTGAGTTAGG - Intergenic
993693619 5:91034047-91034069 TCACAAAACTGTAGTTGGTTAGG - Intronic
997666714 5:135635198-135635220 TTCCACAACTGCAGTGGGGTTGG + Intergenic
1000604268 5:163311649-163311671 TTCCAAAACTGTAGCAGATTTGG + Intergenic
1004608855 6:17219497-17219519 TTGCAAAATTCAAGTGAGTTTGG + Intergenic
1005320095 6:24645079-24645101 TTCCAAAATTCTTGTGTGTGGGG + Intronic
1005348238 6:24910658-24910680 TTCCACCACCCTGGTGGGTTCGG - Intronic
1007893644 6:45323202-45323224 TTCAAAAACTCTATTATGTTCGG + Intronic
1008121183 6:47618900-47618922 TTCTAAAACTTTAGTGCCTTAGG - Intronic
1009776510 6:68212039-68212061 TTCCAAAAATATAGAGGATTTGG + Intergenic
1017020696 6:150137699-150137721 TTGCAATCCTTTAGTGGGTTAGG + Intergenic
1021919340 7:25468369-25468391 TTCCAAAATCCAAGTGGGTAAGG + Intergenic
1023625865 7:42114640-42114662 TTCCAGAAATCTAGTGGTGTAGG + Intronic
1024272325 7:47651742-47651764 TTACAAAATTCTTGTGAGTTGGG - Intergenic
1026005834 7:66599749-66599771 TTCCAAAAATCTACTGGGGCTGG + Intergenic
1026012371 7:66646574-66646596 TTCCAAAAATCTACTGGGGCTGG - Intronic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1028304092 7:89240282-89240304 TCCTCAAACTCTTGTGGGTTAGG + Intronic
1032266111 7:130371101-130371123 ATCCAAGTCTCTAGTGGGTGGGG + Intergenic
1033716345 7:144006789-144006811 TTCCAAAAGTATAGATGGTTTGG - Intergenic
1034389462 7:150773403-150773425 TTACAAAACTCTCCTTGGTTAGG - Intergenic
1037168413 8:15859265-15859287 TCCCAAAACTTTAGTGTGTTAGG + Intergenic
1037900540 8:22685679-22685701 TTACAAAACCCAGGTGGGTTGGG + Intergenic
1038911699 8:31972087-31972109 TTTGAAAACTCTAGTGGGAAAGG - Intronic
1039661538 8:39472226-39472248 TTCCAAAAGTCCAGTGAGTCAGG + Intergenic
1046698705 8:117375201-117375223 CACCATAAATCTAGTGGGTTAGG + Intergenic
1046963718 8:120139093-120139115 TTACAGAACTCCTGTGGGTTGGG + Intronic
1047672951 8:127169062-127169084 TGATAAAACCCTAGTGGGTTAGG + Intergenic
1048875536 8:138834272-138834294 TTCCTAAAATCTCATGGGTTAGG - Intronic
1061843320 9:133373045-133373067 ATACAAAACCCAAGTGGGTTAGG - Intronic
1186909424 X:14146282-14146304 TTCCTAAAATCTGGTGGGGTTGG - Intergenic
1187670368 X:21660074-21660096 TAGCAAAATTCTATTGGGTTGGG - Intergenic
1196013757 X:110915776-110915798 GTCCAAACCTCAAATGGGTTTGG - Intergenic
1196158581 X:112457537-112457559 TTCCAAGACCATACTGGGTTTGG - Intergenic
1199935459 X:152569221-152569243 GTCCATAACTCCAGTGGTTTGGG - Intergenic
1201787298 Y:17799243-17799265 TACCAAAAATTTAGTGGCTTTGG - Intergenic
1201814255 Y:18106745-18106767 TACCAAAAATTTAGTGGCTTTGG + Intergenic
1202332013 Y:23764109-23764131 TACCAAAAGTGTAGTGGCTTTGG - Intergenic
1202349191 Y:23969312-23969334 TACCAAAAATTTAGTGGCTTTGG - Intergenic
1202521584 Y:25700792-25700814 TACCAAAAATTTAGTGGCTTTGG + Intergenic
1202538756 Y:25905951-25905973 TACCAAAAGTGTAGTGGCTTTGG + Intergenic