ID: 955781958

View in Genome Browser
Species Human (GRCh38)
Location 3:62494315-62494337
Sequence CTGCCTAAAAGGCTGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955781958_955781963 5 Left 955781958 3:62494315-62494337 CCAGACACCAGCCTTTTAGGCAG 0: 1
1: 0
2: 2
3: 24
4: 176
Right 955781963 3:62494343-62494365 ATCTAAACCCTGGAACTTGCTGG 0: 1
1: 0
2: 2
3: 17
4: 125
955781958_955781961 -5 Left 955781958 3:62494315-62494337 CCAGACACCAGCCTTTTAGGCAG 0: 1
1: 0
2: 2
3: 24
4: 176
Right 955781961 3:62494333-62494355 GGCAGAGACCATCTAAACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955781958 Original CRISPR CTGCCTAAAAGGCTGGTGTC TGG (reversed) Intronic
900521594 1:3107984-3108006 CTGCCACAGTGGCTGGTGTCAGG + Intronic
900722104 1:4183516-4183538 TCGCCTAGAGGGCTGGTGTCTGG + Intergenic
900841217 1:5050096-5050118 TTGCCTAGAGGGCTGGTGTCTGG - Intergenic
900985616 1:6071487-6071509 CTGCTTAACAGGCTGGGGTGTGG + Intronic
901529493 1:9844212-9844234 CTGCCTCATTGGCTGTTGTCTGG - Intergenic
901671380 1:10858186-10858208 CTGCTTAAAACGCTGGGTTCTGG + Intergenic
902991986 1:20194413-20194435 CTGCCTTGAAGGCTGTTGGCTGG - Exonic
903113169 1:21155494-21155516 CTCCCTAATAGGCTGCTGTTGGG - Intronic
905429614 1:37912041-37912063 TTGCCTAGAGGGCTGGTGTCTGG - Intronic
906692019 1:47798892-47798914 GTGCAGAAAAGCCTGGTGTCAGG - Intronic
907504787 1:54910187-54910209 TCGCCTACAGGGCTGGTGTCTGG + Intergenic
912799357 1:112711539-112711561 CTGCCTTAAGGGCTGTTGTGAGG - Intronic
913095325 1:115510952-115510974 TTGCCTAGAGGACTGGTGTCTGG + Intergenic
915489810 1:156244778-156244800 CTGCCTGAAAGGCTGGCACCAGG - Exonic
916289473 1:163148622-163148644 CTGGTTAAAAGGCTGGGCTCTGG - Intronic
921520423 1:216149631-216149653 TAGCCTAGAGGGCTGGTGTCTGG - Intronic
922198648 1:223382264-223382286 CTTCCTAAAAGACTAGTATCTGG - Intergenic
922368946 1:224890668-224890690 TCGCCTAGAGGGCTGGTGTCTGG - Intergenic
1068361269 10:55977034-55977056 TTGCCTAGAGGGCTGGTGTCTGG - Intergenic
1068887895 10:62116184-62116206 CGGCCTAAATGCCAGGTGTCAGG + Intergenic
1071580967 10:86769936-86769958 CTGGCAAGAAGGCTGGTGCCTGG - Intronic
1072689746 10:97564237-97564259 TCGCCTAGAGGGCTGGTGTCTGG + Intronic
1073130478 10:101185688-101185710 TCGCCTAGAGGGCTGGTGTCTGG + Intergenic
1079321711 11:19456861-19456883 CTGCTTAACAGGCTGATGTGAGG + Intronic
1080387887 11:31820275-31820297 CTTCCTCCAAGGCTGGTGGCAGG - Intronic
1080652861 11:34236505-34236527 CTGCTTAAAATGCTGCTGTTAGG - Intronic
1081713432 11:45232609-45232631 CTCCCCAGAAGACTGGTGTCTGG - Intronic
1083259402 11:61515050-61515072 CTCCCAAAAAGCCTTGTGTCAGG + Intergenic
1084354661 11:68629823-68629845 TCGCCTAGAGGGCTGGTGTCTGG - Intergenic
1084585400 11:70058588-70058610 TTGCCCAGAGGGCTGGTGTCTGG + Intergenic
1085016187 11:73175523-73175545 CTGCCTCCAAGGCTGCTGTGGGG - Intergenic
1085189049 11:74601892-74601914 CTGCCTAGAAGGCTCTTCTCAGG - Intronic
1086950516 11:92885956-92885978 CTTCCAAAAAGGGTGGTGTCAGG - Intronic
1087167619 11:95020860-95020882 TTGCCTAGAGGACTGGTGTCTGG + Intergenic
1089616500 11:119697809-119697831 CTGCCTAGAAAGCTGGAATCTGG - Intronic
1090976117 11:131682291-131682313 CTGCCTGGAAGGCTGCTGTGAGG + Intronic
1091004570 11:131941336-131941358 CTCCCCAAAAGGGTGGTGGCTGG - Intronic
1093358927 12:18200647-18200669 TCGCCTAGAGGGCTGGTGTCTGG - Intronic
1094826219 12:34271180-34271202 TCGCCTAGAGGGCTGGTGTCTGG - Intergenic
1095806295 12:46324195-46324217 TTGCCTAGAGGGCTGGTGTCTGG + Intergenic
1096164938 12:49414639-49414661 CTGTCTCAAAGGCTGGAGTGCGG + Intronic
1097682210 12:62659441-62659463 CTGCCTGAGAGGATGGTGTGAGG + Intronic
1097724397 12:63058334-63058356 ATGTCTAAAAGGCTGGTGGGAGG + Intergenic
1099902896 12:88734596-88734618 CTGCCTACAAGTTTGGTTTCTGG + Intergenic
1101059918 12:100960020-100960042 CTGCCCCAGAGGCAGGTGTCTGG - Intronic
1102483032 12:113236996-113237018 GTGCCTAAAATGCTGATGGCAGG + Intronic
1103874625 12:124117262-124117284 CTGCCCAAATGGCTAGAGTCTGG + Intronic
1113618441 13:111697131-111697153 CTGGCTGGAAGGCAGGTGTCCGG + Intergenic
1113623972 13:111782392-111782414 CTGGCTGGAAGGCAGGTGTCCGG + Intergenic
1114843302 14:26291203-26291225 CTGCTTTCAAGGCTGGTGTTGGG + Intergenic
1115569307 14:34652023-34652045 CCGCCTAGAGGGCCGGTGTCTGG - Intergenic
1118936847 14:70296436-70296458 TCGCCTAGAGGGCTGGTGTCTGG + Intergenic
1119476073 14:74929854-74929876 CTGTTTAAAATTCTGGTGTCAGG - Intergenic
1119649232 14:76371952-76371974 GTGCAAAAATGGCTGGTGTCTGG + Intronic
1119813825 14:77547190-77547212 CTGCCTAGAATGCTGTTGTTTGG - Intronic
1121192818 14:92045030-92045052 TCGCCTAGAGGGCTGGTGTCTGG + Exonic
1122041355 14:98989886-98989908 TCGCCTAGAGGGCTGGTGTCTGG - Intergenic
1131401657 15:92130335-92130357 CTGAATAAAAGGCAGGTGTCTGG - Intronic
1132673009 16:1109454-1109476 CAGCCTCAGAGGCTGGGGTCTGG - Intergenic
1133766374 16:8840943-8840965 TCGCCTAGAGGGCTGGTGTCTGG + Intronic
1134055926 16:11169889-11169911 GTGCCTATAAGCATGGTGTCTGG - Intronic
1135394526 16:22121143-22121165 CTGACTAAAAGGCTTGAATCCGG + Intronic
1135987024 16:27191365-27191387 CTGCCATCAAGGCTGGTGTTCGG + Intergenic
1139008833 16:62607528-62607550 CTGCCTAAAAGCTTGGAGTGAGG - Intergenic
1139263871 16:65621863-65621885 CTGCCTCATAGGCTGGGGTGAGG - Intergenic
1139489320 16:67278281-67278303 CTGCCTGAAAGTCTGGACTCTGG + Exonic
1141514950 16:84537656-84537678 CTGTGAAAAAGGCTGGTGTGGGG + Intronic
1144106712 17:11992692-11992714 CTGCCTGAAAAGCTGGCGTGCGG + Exonic
1145119359 17:20243197-20243219 CTGCCTCTAAGGCTGATGTTAGG - Intronic
1150813906 17:68377955-68377977 TTGCCTGAAAGGCTGCTGCCTGG + Intronic
1152454424 17:80405205-80405227 TTGCCTAGAGGGCTGGTGTCTGG - Intergenic
1155986637 18:32237346-32237368 CTGCCTAATCAGCTGGTGCCTGG - Intronic
1155991739 18:32285393-32285415 GTGGCTGAAAGGCTGGTGCCAGG - Intronic
1156916259 18:42466863-42466885 TCGCCTAGAGGGCTGGTGTCTGG - Intergenic
1156923675 18:42553381-42553403 TCGCCTAGAGGGCTGGTGTCTGG + Intergenic
1158012778 18:52748244-52748266 CTGCCTTCGATGCTGGTGTCTGG + Intronic
1159778631 18:72634642-72634664 CTGCATGGCAGGCTGGTGTCAGG + Intronic
1161303444 19:3554479-3554501 CTGCCTCACAGGCTGCTGTGAGG + Intronic
1161713658 19:5863805-5863827 CTTCCTAACAGGGTGGTGTGGGG - Intergenic
1162091959 19:8286077-8286099 CTGCCAAAAAGGTTGGTGACCGG - Intronic
1162094196 19:8300926-8300948 CTGCCAAAAAGGTTGGTGACCGG - Intronic
1162287316 19:9748833-9748855 TCGCCTAGAGGGCTGGTGTCTGG - Intergenic
1162337900 19:10072976-10072998 CTGCCTCACATGCTGTTGTCTGG - Intergenic
1164220444 19:23188410-23188432 ACGCCTAGAGGGCTGGTGTCTGG + Intergenic
1164951432 19:32340333-32340355 CAGCCTAAGAGTTTGGTGTCTGG - Intergenic
1166397172 19:42449946-42449968 TTGCCTAGAGGGCCGGTGTCTGG + Intergenic
1166905299 19:46104155-46104177 TCGCCTAGAGGGCTGGTGTCTGG + Intergenic
1167831444 19:52026191-52026213 ATGCCTCAGAGGCAGGTGTCTGG + Intronic
1168649958 19:58086544-58086566 CTCCCTAAAAGGAGGGTTTCTGG + Intronic
926206592 2:10838268-10838290 TTGGCTAAAAGGCTGGCGTTGGG + Intergenic
927416752 2:22888239-22888261 CTGTCTAAAAGGCTTGGGTCAGG - Intergenic
928861450 2:35862081-35862103 CTACCTATAAGGTTGATGTCAGG + Intergenic
929570310 2:43018776-43018798 TTGGCTACAATGCTGGTGTCAGG + Intergenic
929921242 2:46173057-46173079 CTGCCTCAAAGGATGGCTTCAGG - Intronic
930165434 2:48199326-48199348 CAGCCTAAAGGGGTGGAGTCCGG - Intergenic
931942600 2:67269002-67269024 ACGCCTAAAAGCCTGGTGCCTGG - Intergenic
932217538 2:69976534-69976556 CTGGGGAAAAGTCTGGTGTCAGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933591348 2:84236267-84236289 CTATCTAAAAGCCTTGTGTCTGG - Intergenic
934656554 2:96119407-96119429 CTGCCTGAGAGCCTGGTGACTGG - Intergenic
935224647 2:101042947-101042969 CTGCAGAAAAGGCGTGTGTCCGG - Intronic
937329735 2:121019048-121019070 CGGCCTGAAAGGCTGCTGTGGGG - Intergenic
941455703 2:165710585-165710607 TCGCCTAGAGGGCTGGTGTCTGG + Intergenic
942088057 2:172461998-172462020 CTGCCTTTAAGGCTGGTTCCAGG + Intronic
942307798 2:174625573-174625595 CTGCCTCATAGGCTGGTGGAGGG + Intronic
943790625 2:191928329-191928351 CTGCCCACAAGGCTGGTCTGTGG - Intergenic
945725011 2:213464753-213464775 CTGGCTCAAAGGTTGTTGTCAGG - Intronic
948648225 2:239422396-239422418 CTGGCACAGAGGCTGGTGTCTGG + Intergenic
948756430 2:240162185-240162207 CTGCCTCAGAGGCTGGGGTCAGG + Intergenic
1169035247 20:2445450-2445472 CTTCCCAAAAGGCTGGTGGGAGG - Intergenic
1169581577 20:7029159-7029181 GTGCCAAAAAGGCTGGGGACTGG - Intergenic
1171793874 20:29551435-29551457 CTAGCTCAAAGGCTGCTGTCAGG + Intergenic
1171854597 20:30332956-30332978 CTAGCTCAAAGGCTGCTGTCAGG - Intergenic
1173425878 20:42943194-42943216 CTGCCAAAAAGGCTGAGGTTGGG + Intronic
1174676725 20:52364735-52364757 CTGCGTGAAAGCCTGGTGTCAGG + Intergenic
1174894861 20:54437446-54437468 CTGGCTAAGAGTCTGGAGTCTGG - Intergenic
1178588624 21:33890844-33890866 GTGTCTAAAAGGCTGGGATCAGG - Exonic
1178715209 21:34958114-34958136 CTGTCTAACAGGCTGATGTGTGG + Intronic
1179245653 21:39632094-39632116 CTGCCTGACAGCCTGGTGGCTGG + Intronic
1179983130 21:44906802-44906824 CTGCCCAGAAGGCATGTGTCCGG - Intronic
1180903631 22:19392959-19392981 GTTCCTGAAAGCCTGGTGTCAGG + Intronic
1182618549 22:31604998-31605020 CCCCCTAAAAGGCTGGGGTTTGG - Intronic
949680821 3:6512509-6512531 CTGCTCAAAAGGCTGCTGTCTGG + Intergenic
950867891 3:16203963-16203985 CTGTCTCCAAGGCTTGTGTCAGG + Intronic
951682293 3:25307348-25307370 CTGTCTCAAAGGCTGGAGTGTGG - Intronic
952297367 3:32073200-32073222 TTGCCTAGAGGGCTGGTGTCTGG - Intronic
952851398 3:37732658-37732680 CTGCACAAAAGGCAGGTGTGTGG - Intronic
953033155 3:39190952-39190974 CTGCCTCCTGGGCTGGTGTCAGG + Intronic
955401213 3:58592871-58592893 TTGCCTAGAAGGCTGGTGTCTGG - Intronic
955781958 3:62494315-62494337 CTGCCTAAAAGGCTGGTGTCTGG - Intronic
957918199 3:86713707-86713729 CTCCCTAAAAGGTTGTTGTGAGG + Intergenic
961356445 3:126342971-126342993 CCACCCTAAAGGCTGGTGTCTGG + Exonic
962319442 3:134378368-134378390 TTGCAGAAAAGGCAGGTGTCTGG - Intergenic
965458551 3:168932719-168932741 TCGCCTAGAGGGCTGGTGTCTGG + Intergenic
965902057 3:173653868-173653890 CTTCCTAACAGCATGGTGTCTGG - Intronic
966067293 3:175833200-175833222 TCACCTAGAAGGCTGGTGTCTGG - Intergenic
966076443 3:175940981-175941003 CTGCCTCTGAGGCTGGTGGCTGG - Intergenic
966278551 3:178204506-178204528 TTGTCTAAAATGTTGGTGTCTGG - Intergenic
967087363 3:186107949-186107971 CTTCCTAAAACGCTGGGGTGAGG - Intronic
968412550 4:402557-402579 TTGTCTAGAGGGCTGGTGTCTGG + Intergenic
970819468 4:20196186-20196208 TTGCCTAGAAGGCTGGTGTCTGG - Intergenic
971778797 4:31003960-31003982 CAACCTAAAATGCTGATGTCAGG - Intronic
973205407 4:47554741-47554763 TTGTCTAAAAGCCTGGTGTCTGG - Exonic
974377642 4:61098458-61098480 CTGGCTAAATGATTGGTGTCTGG - Intergenic
980714899 4:136615889-136615911 TCGCCTAGAGGGCTGGTGTCTGG - Intergenic
987229911 5:15883227-15883249 CTGCCTAAAAGCCTTGTGATGGG + Intronic
989162478 5:38404743-38404765 CTGCCCTAAAGGCTGGTGCCTGG + Intronic
989660279 5:43790728-43790750 TCGCCTAGAGGGCTGGTGTCTGG - Intergenic
991491413 5:67187425-67187447 CTGCCCAAAAGCCTACTGTCTGG - Intronic
996358260 5:122619902-122619924 TTGCCTAGAGGGCTGGTGTCTGG + Intergenic
997157803 5:131577473-131577495 TCGCCTAGAGGGCTGGTGTCTGG - Intronic
997659854 5:135580962-135580984 ATGGCTAAGAGGCTGGTGTCTGG + Intergenic
1001818765 5:174693406-174693428 CTGACTTAAAGGGGGGTGTCGGG + Intergenic
1003281329 6:4694782-4694804 CTGCTTATAAGGTTGGGGTCAGG - Intergenic
1003683341 6:8277471-8277493 CTTCCCAAAATGCTGGTGGCGGG - Intergenic
1005284933 6:24315290-24315312 CTGCAGTAAAGGCTGGTGGCTGG - Intronic
1005786082 6:29247304-29247326 TTGCCCAGAGGGCTGGTGTCTGG + Intergenic
1005923412 6:30419647-30419669 GTGCCAAAAAGGCTGGTCCCAGG - Intergenic
1007721924 6:43890337-43890359 CTGCCCCAGAGGCTGGTGTGAGG - Intergenic
1008970293 6:57359351-57359373 ATGCTTAAAAGGCTGGGCTCAGG - Intronic
1009159261 6:60261175-60261197 ATGCTTAAAAGGCTGGGCTCAGG - Intergenic
1010040960 6:71383404-71383426 CTGCCAAAAAGGCTGGGGACCGG - Intergenic
1010586262 6:77661016-77661038 TCGCCTAGAGGGCTGGTGTCTGG + Intergenic
1014371572 6:120615654-120615676 CTGCCTGAAAGGATGATGTGAGG + Intergenic
1019485842 7:1288828-1288850 CTGCCCACCAGGCTGGTGCCAGG + Intergenic
1019517056 7:1444766-1444788 CTGCCAGAAAGGCTGGTGCCGGG + Exonic
1022373224 7:29789523-29789545 TCGCCTAGAGGGCTGGTGTCTGG - Intergenic
1023252456 7:38280056-38280078 TTGCATAAAAGACTCGTGTCTGG + Intergenic
1024336851 7:48217503-48217525 CTACCTAATAGGGTGGTGTGAGG - Intronic
1026512840 7:71041444-71041466 ATGCCAACAAGTCTGGTGTCTGG + Intergenic
1027242033 7:76337174-76337196 CTGCTTACAAGGCTGGTCTCTGG + Intronic
1029958115 7:104660767-104660789 ATGCCTAAAGGGCTGTTGTGAGG - Intronic
1037667854 8:20986154-20986176 CTGCCTAAAAAGATGATGCCAGG + Intergenic
1038048248 8:23785368-23785390 CTGCCTAAAAAGCAGGAGTATGG - Intergenic
1038724521 8:30068625-30068647 GTGCCAAAAAGGCTGGGGACTGG + Intronic
1041373486 8:57189348-57189370 GTGCCAAAAAGGCCGGGGTCTGG + Intergenic
1041748783 8:61236912-61236934 CTGCCTACAATGCTGGTGGATGG + Intronic
1042481255 8:69306003-69306025 TTGCCCTAAAGCCTGGTGTCTGG + Intergenic
1043721275 8:83548795-83548817 TTGCCCAGAGGGCTGGTGTCTGG - Intergenic
1045645144 8:104290622-104290644 TCGCCTAGAGGGCTGGTGTCTGG - Intergenic
1047718012 8:127613569-127613591 CTGCCTCAGTGGCTGGTGTAGGG + Intergenic
1047903987 8:129453417-129453439 TTGGCTAAAAGGCTGGTGGGAGG - Intergenic
1049433314 8:142575193-142575215 CTCCCTGAAGGGCTGGTGTGGGG - Intergenic
1049689230 8:143951488-143951510 CTGCCTCTAAGCCTGGTGTGTGG - Intronic
1049707118 8:144048128-144048150 GGGACTAAGAGGCTGGTGTCTGG - Intergenic
1053174449 9:35911949-35911971 CTGCGTCGAGGGCTGGTGTCAGG - Intergenic
1053792417 9:41696236-41696258 CTAGCTCAAAGGCTGCTGTCAGG - Intergenic
1054152757 9:61618584-61618606 CTAGCTCAAAGGCTGCTGTCAGG + Intergenic
1054180826 9:61908256-61908278 CTAGCTCAAAGGCTGCTGTCAGG - Intergenic
1054472533 9:65549732-65549754 CTAGCTCAAAGGCTGCTGTCAGG + Intergenic
1054656765 9:67672886-67672908 CTAGCTCAAAGGCTGCTGTCAGG + Intergenic
1056324320 9:85463894-85463916 TCGCCTAGAGGGCTGGTGTCTGG - Intergenic
1057299367 9:93868468-93868490 CAGCCATAAAGGTTGGTGTCAGG - Intergenic
1057342367 9:94214289-94214311 CAGCCTTAAAGGTGGGTGTCGGG - Intergenic
1060226569 9:121795017-121795039 TCGCCTAGAGGGCTGGTGTCTGG - Intergenic
1060732814 9:126048942-126048964 CTGCCCTAGAGGCTGGTGTCGGG - Intergenic
1187259315 X:17670643-17670665 CTGTCAAAAATGCTTGTGTCTGG + Intronic
1190311125 X:49117646-49117668 CAGCCTCAAGGGCTGGTGCCTGG - Exonic
1194412671 X:93576534-93576556 CTACCTAAAAGGTTGTTGTGAGG - Intergenic
1196711590 X:118769219-118769241 CTGCCTAAAACAATGGTGCCAGG + Intronic
1201724420 Y:17137294-17137316 TTGCCTAGAAGGCTGATGTCTGG + Intergenic
1201937578 Y:19424653-19424675 TTGCCTAGAGGGCTGGTGTCTGG - Intergenic
1202076076 Y:21039116-21039138 TCGCCTAGAGGGCTGGTGTCTGG + Intergenic