ID: 955784159

View in Genome Browser
Species Human (GRCh38)
Location 3:62518668-62518690
Sequence GCTTCTTCCTTACCTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955784159 Original CRISPR GCTTCTTCCTTACCTGGGAC AGG Intronic
900716495 1:4148444-4148466 TCTTCTTCTATACATGGGACAGG - Intergenic
901150746 1:7099627-7099649 GGCTCTTCCTTACCTGGGGGAGG + Intronic
903181851 1:21608766-21608788 GCTTTTCCCTTCCCAGGGACAGG + Intronic
903665898 1:25007258-25007280 GTTTCCTCCTTCCCTAGGACGGG - Intergenic
904670769 1:32163304-32163326 TCCTCTTTCTTACCTGGGTCTGG - Exonic
907178817 1:52552755-52552777 ACTTCTTTCTTTCCTGGAACGGG - Intronic
907704278 1:56819452-56819474 GCTCCTCCCTTGCCTGGGGCTGG + Intronic
909208422 1:72791089-72791111 GCTTCTTCCTTCATTTGGACAGG + Intergenic
916438264 1:164796976-164796998 GCTCCTTCCTTCCCAGGTACTGG + Intronic
920493870 1:206440271-206440293 GCTGTTTCCTTCCCTGGAACAGG - Intronic
920679683 1:208062950-208062972 GCTGCTTCCTTACCTGCTGCAGG + Intronic
920939189 1:210464922-210464944 GTTTCTTACTAACCTGGGAAAGG + Intronic
921501304 1:215907002-215907024 GCTTGTGCCTTACCAGTGACAGG + Intronic
1067221444 10:44347032-44347054 GCTTCATGCTGACCTGGGAGGGG - Intergenic
1067776729 10:49169855-49169877 TCTTCACCCTTTCCTGGGACGGG + Intronic
1069006873 10:63327503-63327525 GCTTCTTCCTTAGTTGTAACTGG - Intronic
1070221202 10:74447387-74447409 GCTTCTTCTCTTCCTGGTACTGG + Intronic
1073447532 10:103590420-103590442 GCTTGTTCCTCAGCTGGGACTGG - Exonic
1074144059 10:110701059-110701081 GCTTCTGCCTTATCTGGGAGGGG + Intronic
1075998348 10:126895867-126895889 GCTGCTCCCTTACATGGGCCAGG + Intergenic
1078410866 11:11116433-11116455 ACTTCTTCCTCACTTGGTACTGG + Intergenic
1079205287 11:18409664-18409686 GCCTATTCCTTGCCTGGGGCAGG - Intergenic
1080581940 11:33651491-33651513 GCCTCCTTCTTCCCTGGGACAGG + Intronic
1080590310 11:33717716-33717738 GCTTCCTCCTAACCTGCAACTGG + Intronic
1080837196 11:35950138-35950160 CCTTCTTCGTTATCTGGGAAGGG + Intronic
1081891740 11:46548404-46548426 GCTCCTTCATTTCCTGGGCCTGG - Exonic
1083857303 11:65399603-65399625 GTTTCTCCCTTCCCTGGGGCGGG + Intronic
1084496044 11:69504316-69504338 GCCTCATCCCTCCCTGGGACAGG + Intergenic
1085767442 11:79295440-79295462 GCTCCTTCCTTTCCCGGGGCGGG - Intronic
1091443018 12:526392-526414 TCTTCTTTCTGGCCTGGGACAGG - Intronic
1096576573 12:52556527-52556549 GATTCTCCCATACCTGGGAGGGG - Intergenic
1096771724 12:53939633-53939655 GTCCCTTCCTTACCTGGGAAGGG - Exonic
1099862088 12:88233790-88233812 GCTTTTTCCTGACTTGGGAAGGG - Intergenic
1103461740 12:121110451-121110473 GCTTTTGCCTGACCTTGGACGGG - Intergenic
1105886925 13:24650284-24650306 ACTCATTCCTTAACTGGGACAGG + Intergenic
1115434174 14:33354698-33354720 GTTTCTTCCTTTCCTGTGATAGG - Intronic
1118255028 14:64198389-64198411 AATACTTCCTGACCTGGGACAGG + Intronic
1118405694 14:65421619-65421641 CCTTCTACATTACCTGGTACTGG + Intronic
1119225737 14:72943446-72943468 GCTTCTTCCTGAACTGGGGCAGG + Intronic
1121809623 14:96871927-96871949 TCTTCTGCCTCAGCTGGGACTGG + Intronic
1122283793 14:100639183-100639205 GCTCCTGCCTGACCTGGGCCTGG + Intergenic
1123707685 15:22961982-22962004 ACTGCTTCCTTCCCTGGGCCTGG - Intronic
1124129697 15:26972584-26972606 GCTTCTCCATTTCCTGGGTCTGG + Intronic
1125889613 15:43255748-43255770 CCCTCTTCCTTGCCTGGCACTGG + Intronic
1127574032 15:60272860-60272882 GCTTTCTCCTTTCTTGGGACAGG + Intergenic
1130889051 15:88117882-88117904 TCTGCTTCCTTCCCTGGAACAGG + Intronic
1131427813 15:92361142-92361164 CCTTCTACCTTATCTGGGACAGG - Intergenic
1132110448 15:99098881-99098903 GCATCTTCCTCACCTGGGAATGG + Intronic
1132409887 15:101568853-101568875 GCTTCTTCCCCTCCTGGGAGGGG + Intergenic
1132603324 16:783492-783514 GCTTCTCCCCTCACTGGGACAGG + Intergenic
1135810904 16:25585893-25585915 GGTTCTTCCTTCCCTGGGGCAGG - Intergenic
1138104384 16:54279910-54279932 CCTCATTCCTCACCTGGGACAGG + Intergenic
1138268614 16:55678665-55678687 TTTTCTTCCTCACCAGGGACCGG - Intronic
1138496512 16:57412268-57412290 GCTGCTTCCGCACCTGGGAGTGG - Intronic
1141280559 16:82627128-82627150 CCCTCTTCCCTACCTGGGACAGG - Exonic
1146082302 17:29791411-29791433 TCTTCTTTGTTACCTGGAACTGG + Intronic
1147563445 17:41522522-41522544 GCCTCTTCCTTACCTTGAATTGG + Intronic
1147647609 17:42043208-42043230 GCTTGTTCCGTACCAGGGCCTGG + Intronic
1149630759 17:58120498-58120520 TCTTCTTCCTTACCTGTTTCAGG - Intergenic
1150270314 17:63860012-63860034 GCTCCTTCCTTTCCTGGGAGGGG + Intergenic
1152680975 17:81667680-81667702 GCTTGTGCTTTACTTGGGACGGG + Intronic
1153146509 18:2039012-2039034 CCTTCTATCTTACCTGGCACTGG - Intergenic
1156587161 18:38444222-38444244 TCTTATTCTTTATCTGGGACTGG + Intergenic
1157502425 18:48200932-48200954 GCTTCATCCTGACCAGGGTCAGG - Intronic
1160149793 18:76390461-76390483 GCTGCTTCCTGGCTTGGGACTGG - Intronic
1160622727 18:80181866-80181888 GCTGCTTCCCTCCCAGGGACAGG - Intronic
1162060035 19:8089487-8089509 GCTCCTTCCTGTCCTGGGAGGGG + Intronic
1163452022 19:17383994-17384016 CCTACTTCCTTGCCTGTGACTGG + Intergenic
1164419653 19:28077782-28077804 GCTGCTCCCTTCCCTGGGAGTGG + Intergenic
1165115007 19:33523332-33523354 TCGTTTTCCTTATCTGGGACCGG - Intergenic
1165986026 19:39769708-39769730 GGATCTTCCTTTCCTGGGAAAGG - Intergenic
925203694 2:1989268-1989290 GCTGCTCCCTTGCCTGGCACAGG - Intronic
927815689 2:26215219-26215241 GGTTTTTCACTACCTGGGACTGG - Intronic
928319887 2:30274592-30274614 GCTTCATTTTGACCTGGGACAGG - Intronic
929134728 2:38612818-38612840 GCGTCTTCCTTCCCCGGGAAGGG - Intergenic
929924732 2:46198709-46198731 GCACCGTCCTGACCTGGGACTGG + Intergenic
932171968 2:69565614-69565636 TCTTCTCCCTTCCCTGGGAGTGG - Intronic
934514490 2:94977719-94977741 GCCTCTTCCCAACCTGGGCCAGG + Intergenic
934769124 2:96896675-96896697 GCTTCCTCCTCACCTAGGACAGG + Intronic
938919846 2:135985376-135985398 GTTTCCTCCTTTCCTGGGCCTGG - Intronic
941664295 2:168228861-168228883 GCTTTTTCCTTACATGAGAAAGG + Intronic
943025450 2:182622663-182622685 GCTTCCTACTGACCTGGGAGTGG - Intergenic
945344040 2:208691720-208691742 GCTTCTGCCTCACCTCTGACTGG + Intronic
947886210 2:233573804-233573826 GCTTCTCCCATACCTGAGACAGG - Intergenic
1171308152 20:24123678-24123700 CTTTATTCCTGACCTGGGACTGG + Intergenic
1172188870 20:33049578-33049600 TCTACTTCCTTATCTGGGATTGG - Intergenic
1174112500 20:48206049-48206071 GCTTCATCCTTCCCTGGGGCTGG - Intergenic
1175521298 20:59604211-59604233 GGTCCTTCCTCTCCTGGGACTGG - Intronic
1181672296 22:24431352-24431374 GCTGCAGCCATACCTGGGACTGG - Intronic
1182353536 22:29711755-29711777 ACTCCTTCCTTGCCTGGGGCTGG - Intergenic
1184485458 22:44776006-44776028 GCTTCTGACTTACCTGGGAGAGG - Intronic
1184760802 22:46542925-46542947 GCATCTCCCTTACCTGAGCCTGG - Intergenic
1184851604 22:47124473-47124495 GCCTCTTCTTGACCTGGGCCTGG + Intronic
1185023990 22:48397158-48397180 GCTGCTTTCTCACCGGGGACAGG - Intergenic
1185080767 22:48708292-48708314 GCTCCTTCCGTCCCTGGGCCTGG + Intronic
950104111 3:10377497-10377519 GCTACCTCCTTACCCGGGAGGGG + Intronic
950649213 3:14396727-14396749 GCTCCATCCTTACCTGGGGCAGG - Intergenic
950894975 3:16440495-16440517 GCTTCTCCCCTACCTGGGCAGGG + Intronic
954585704 3:51734473-51734495 TCTTCTTCCTTAGGTGGAACAGG + Intergenic
955784159 3:62518668-62518690 GCTTCTTCCTTACCTGGGACAGG + Intronic
962292397 3:134147447-134147469 GCTTCTTCATTCCCAGGGCCTGG + Intronic
962752037 3:138440645-138440667 GCCTCTTCCTTCCCGAGGACAGG - Intronic
964260633 3:154831779-154831801 TCTTTTTCCTTACCTGTGAGAGG - Intergenic
966367381 3:179204579-179204601 TATACTTCCTTACCTGGGATTGG - Exonic
974423891 4:61715192-61715214 GCTTCTTTCTTACATTCGACTGG + Intronic
976078681 4:81329460-81329482 GCTTCTGCACTACCAGGGACAGG - Intergenic
977673465 4:99722295-99722317 TCCTCTTCCTTCCCTGAGACAGG - Intergenic
978067990 4:104429554-104429576 GCATCTTCCGAAGCTGGGACTGG + Intergenic
979693388 4:123584374-123584396 GCTTCTTCCCGACATGGCACTGG + Intergenic
984067330 4:175064166-175064188 GATTCTTCCTTTCCTTGGATTGG + Intergenic
986241181 5:5961352-5961374 GCTTCTCCTTGACCTGGGACTGG - Intergenic
987382624 5:17299913-17299935 GTTTCCTTCTTACCTGGGAATGG + Intergenic
989019743 5:36989360-36989382 GTTTATTCCTTGCCTGGGAGGGG + Intronic
992107366 5:73461011-73461033 TCCTCCTTCTTACCTGGGACTGG + Intergenic
997938264 5:138133661-138133683 GCTTTTCCCTTAAGTGGGACAGG + Intronic
1001951304 5:175818396-175818418 GCTTCCTCCTAGCCTGGGACAGG - Intronic
1002278842 5:178119426-178119448 ACATCTGCCTTACCTGGGCCTGG + Intronic
1006350400 6:33516801-33516823 GCTCCTTCCTTAGCTGGGCATGG + Intergenic
1006868851 6:37232017-37232039 GCTTTCTCCTTACCTGAAACTGG + Intronic
1007493529 6:42243178-42243200 GCTACTTACTAACCTGGGCCTGG + Intronic
1011700672 6:89951492-89951514 GCTTCTTCCTTCTCTGCTACGGG + Exonic
1017044966 6:150338300-150338322 GATTCTGCCTTCCCTGGGACTGG - Intergenic
1017827371 6:158091912-158091934 TCTTCTTGCTTTCCAGGGACTGG + Intronic
1019322841 7:423414-423436 GCTGTGTCCTTACATGGGACAGG - Intergenic
1019558442 7:1644081-1644103 GCTGGTTCCTGCCCTGGGACAGG - Intergenic
1021078190 7:16330948-16330970 CCTTCATCCTTAAATGGGACAGG - Intronic
1021087100 7:16433622-16433644 GCTTCTTCATATCTTGGGACTGG + Intergenic
1026835943 7:73639177-73639199 GTTTCTTCCTGGCCTGGGATGGG - Intergenic
1028262504 7:88683691-88683713 GGCTCTTCCCTACATGGGACTGG - Intergenic
1028808305 7:95054569-95054591 CCTTCTACTTCACCTGGGACAGG - Intronic
1030923382 7:115420578-115420600 GCTTTTTCCTACCCTGGTACTGG + Intergenic
1031870671 7:127087089-127087111 GGTGCTTCCTTAACTGTGACAGG + Intronic
1033602150 7:142896249-142896271 GCATCTTCCTGAACTGGGGCAGG - Intergenic
1035655513 8:1302122-1302144 CCTTGCTCCATACCTGGGACGGG + Intergenic
1036512842 8:9416779-9416801 GCATCCTCAGTACCTGGGACAGG - Intergenic
1037017444 8:13925972-13925994 ACTTTTTCCTTCCCCGGGACTGG + Intergenic
1038400355 8:27279816-27279838 GCTTCTGTCTTCCCTGGTACTGG + Intergenic
1038939722 8:32291058-32291080 GCTTTTTCCTGACTTTGGACTGG - Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1041519739 8:58742130-58742152 GCATCTTCCCTCCATGGGACAGG - Intergenic
1043573742 8:81633090-81633112 GCTTCTTGCTCACCTGACACAGG - Intergenic
1045889766 8:107141670-107141692 GCTTATTCCTGAGCAGGGACAGG + Intergenic
1046472004 8:114688045-114688067 ATTTCTCCCTTATCTGGGACTGG - Intergenic
1046890520 8:119416595-119416617 GCTTCTCCATCTCCTGGGACAGG + Exonic
1048506295 8:135025325-135025347 GCGTCTTCCATACCTGGAGCTGG + Intergenic
1050279540 9:4035842-4035864 GCTCCTTCATCTCCTGGGACTGG + Intronic
1053364933 9:37516073-37516095 GGTTCTTTATTACCTGGGAGAGG + Exonic
1053493697 9:38532887-38532909 GCTTGTTCCCTACCTGGTGCAGG + Intergenic
1055153594 9:73034047-73034069 ACTTCTTCCTTACATGTTACAGG - Intronic
1055245638 9:74239207-74239229 GCTTCTTCCAGGTCTGGGACAGG + Intergenic
1056482814 9:87022993-87023015 TTTTCTTCCTTATCTGTGACTGG - Intergenic
1059975132 9:119707865-119707887 GCTTCTCCCATGCCTGGAACAGG + Intergenic
1060421571 9:123472950-123472972 GCTTCCTCCTTGCCCGGGGCTGG + Intronic
1060875166 9:127077867-127077889 GCTGCTTCCTTAGCTGGAAAAGG + Intronic
1061713120 9:132501265-132501287 GCTTCTTCCTCACCTGCAAATGG + Intronic
1062312208 9:135944897-135944919 GCTTCTCTCTCTCCTGGGACAGG + Intronic
1190284754 X:48954715-48954737 GCTTTTTTCTTCCCAGGGACAGG - Intronic
1190380678 X:49837162-49837184 GCTTCATCCTTTTCTGGGAAGGG + Intergenic
1192070540 X:67935987-67936009 GCTTTTTCCTTCTCTGTGACAGG + Intergenic
1192902903 X:75519260-75519282 GCTTCTTATTTTCCTGGGTCAGG + Intronic
1199307445 X:146283407-146283429 CCTGCTTCCTTACCTGGAAAAGG - Intergenic
1200214553 X:154361869-154361891 TCTCATTCCTTACCTGGGAGAGG - Intronic