ID: 955786964

View in Genome Browser
Species Human (GRCh38)
Location 3:62551037-62551059
Sequence GGTTGGCATCACCATGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955786964_955786968 7 Left 955786964 3:62551037-62551059 CCTCTCTCATGGTGATGCCAACC 0: 1
1: 0
2: 1
3: 5
4: 116
Right 955786968 3:62551067-62551089 AAGTACCATGAGTATGCTGATGG 0: 1
1: 0
2: 1
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955786964 Original CRISPR GGTTGGCATCACCATGAGAG AGG (reversed) Intronic
900723435 1:4196435-4196457 GGTTGGCAACACAATAATAGGGG + Intergenic
901032217 1:6313832-6313854 GCTTGGCTTCAACAAGAGAGAGG - Intronic
903186646 1:21633126-21633148 GGTTGGGCTCTCCAGGAGAGTGG - Intronic
906155225 1:43609985-43610007 GGTGGACAGCCCCATGAGAGTGG - Intronic
906165081 1:43680081-43680103 GGAAGGCAGCACCATGAGAAGGG + Intronic
906327342 1:44855359-44855381 GGTTGCAATCATCATGAGATGGG - Intronic
911581927 1:99644139-99644161 GATTGGTATCATCATGTGAGTGG - Intergenic
914332209 1:146682866-146682888 AGTTGGCATCACCAGGTAAGGGG - Intergenic
915532179 1:156509026-156509048 GGGTGGCATCACCATCAGCTGGG + Intergenic
915935308 1:160087234-160087256 GGTTGGCATCACCAAATGACAGG + Intronic
915952006 1:160195719-160195741 GGTTGGGTTTAACATGAGAGGGG - Intronic
916897537 1:169181037-169181059 GGTTTCCATTAGCATGAGAGAGG - Intronic
917071129 1:171152155-171152177 GGTTGGCTTCTCCATTAGTGGGG - Exonic
918177059 1:182056236-182056258 GGCTGGCAATACCATGTGAGTGG + Exonic
921760594 1:218909343-218909365 GGTAGGCATCAATATGAAAGTGG + Intergenic
923735590 1:236604038-236604060 GGCTGGCATCACTTTGAGGGAGG + Exonic
1062997104 10:1876462-1876484 GGGTGGCATTAGCAAGAGAGGGG - Intergenic
1063590796 10:7393913-7393935 GAGTGGCATCAACAAGAGAGTGG - Intronic
1064384357 10:14878017-14878039 GCTTGGCAACAACATGGGAGGGG + Intergenic
1067032552 10:42888167-42888189 GGTGGCCATGACCATGGGAGAGG - Intergenic
1070919460 10:80175103-80175125 CGGTGGCATCACCTTCAGAGAGG + Intronic
1071000704 10:80827853-80827875 GGTTGGCAAGACCATCAGGGAGG - Intergenic
1073381405 10:103080576-103080598 GGTTGGCATCCCCAAGTGGGAGG + Exonic
1073704942 10:105972708-105972730 GTTCAGCATCAACATGAGAGAGG - Intergenic
1077315566 11:1918012-1918034 GGTTGGCCCCACCATGGGAGAGG + Intergenic
1077336062 11:2005140-2005162 GGGTGGCACCAACATGAAAGTGG + Intergenic
1080052924 11:27875088-27875110 GGTTGTGATCACAGTGAGAGAGG - Intergenic
1080178585 11:29395738-29395760 GTGTGGTATCACCATGAGACTGG + Intergenic
1080381465 11:31776061-31776083 GGGTGGCTTCAGCCTGAGAGGGG + Intronic
1081590443 11:44419230-44419252 GGTTGGCATAACCTGTAGAGAGG - Intergenic
1084501654 11:69538913-69538935 GGCTGCCATCCACATGAGAGGGG - Intergenic
1088455899 11:110032865-110032887 AGGTGGCACCACCATGAAAGGGG + Intergenic
1088818041 11:113434728-113434750 GGTTGGCAGCACCCTGTGGGAGG + Intronic
1202819046 11_KI270721v1_random:60322-60344 GGGTGGCACCAACATGAAAGTGG + Intergenic
1103746264 12:123126496-123126518 GGTTTGCATGACCACCAGAGGGG - Intronic
1109221924 13:59648581-59648603 TGTTGGCAACACCCTGAGAGTGG - Intergenic
1119122820 14:72095761-72095783 GAATGTCATCACCATGAAAGTGG + Intronic
1124404899 15:29383934-29383956 GGGTGGCATGGCCATGGGAGGGG - Intronic
1125520309 15:40344683-40344705 GCTTGCCATCCCCATGAGACTGG + Intergenic
1130716124 15:86336574-86336596 GGCTGGCATCAGCATGAGGAGGG + Intronic
1130878178 15:88032248-88032270 GGTTGGAACCAACAGGAGAGGGG + Intronic
1132120199 15:99169384-99169406 GGTTGGAGGCATCATGAGAGAGG + Intronic
1132659271 16:1054295-1054317 GGTGGGCAGCACCAGGAGGGTGG - Intergenic
1135425018 16:22328129-22328151 GGTTGGCATCTTCAGGAGGGAGG + Intronic
1135467926 16:22703174-22703196 TGTTAACATCACCCTGAGAGAGG + Intergenic
1137748302 16:50839981-50840003 GGTTGGCATCACCATTCCGGGGG + Intergenic
1139281062 16:65770872-65770894 TGTTGGTATCACTTTGAGAGAGG + Intergenic
1140001343 16:71028052-71028074 CGTTGGCATCACCAGGTAAGGGG + Intronic
1140189159 16:72800100-72800122 GCTTGGCATCACCATCTCAGGGG + Exonic
1141789364 16:86223970-86223992 TGGTGTCATCACCATGAGGGGGG - Intergenic
1147686003 17:42287392-42287414 GGTTGGCAGCACCAGAGGAGGGG - Intergenic
1148990027 17:51657942-51657964 AGTTGGCATTACCATGTGAAAGG + Intronic
1152929010 17:83100628-83100650 GGTTGGCAGGACCGTGAGGGGGG + Intergenic
1152929028 17:83100676-83100698 GGTTGGCAGGACCGTGAGGGGGG + Intergenic
1152929047 17:83100725-83100747 GGTTGGCAGGACCGTGAGGGGGG + Intergenic
1152929085 17:83100822-83100844 GGTTGGCAGGACCGTGAGGGGGG + Intergenic
1155647680 18:28099838-28099860 GGTAGGTATCACCTTTAGAGTGG + Intronic
1157393813 18:47325565-47325587 GGTTGAAAGCACCATGGGAGGGG + Intergenic
1159820268 18:73132250-73132272 GATGGACATCAACATGAGAGAGG + Intergenic
1161660069 19:5540430-5540452 GGTTCCCATCAGCATGACAGTGG - Intergenic
1162571694 19:11478210-11478232 GGTTGGGGACACCATGGGAGGGG - Intronic
1163387474 19:17008641-17008663 GGTTGACATGCCCAAGAGAGAGG - Intronic
927462036 2:23307538-23307560 GGTTGTCCTCACCATCAGTGAGG - Intergenic
928352551 2:30573400-30573422 GGGTGGCATCACACTGAGATAGG + Intronic
929863327 2:45697558-45697580 GGTTGGCATCTCTATGTGGGTGG + Intronic
931208265 2:60168482-60168504 GTCTGCCATCACCATGAGGGTGG - Intergenic
931624376 2:64243699-64243721 GGTTGGCCTCCCCTTGTGAGAGG + Intergenic
937244228 2:120482276-120482298 GGTTGGTATTCTCATGAGAGTGG + Intergenic
937441359 2:121918675-121918697 GGGTGACATCAGCAGGAGAGTGG + Intergenic
948864214 2:240767258-240767280 GGATGGGATCACCAGGTGAGAGG - Exonic
1169607066 20:7333717-7333739 GGCTGGCCTCATCATGAGAAAGG - Intergenic
1170445646 20:16424655-16424677 AGTAGGCATCAGCATGAGAGTGG + Intronic
1171818819 20:29813748-29813770 TTTTTGCATCACTATGAGAGTGG + Intergenic
1174378429 20:50141268-50141290 GGTTCCCATCACCATCTGAGAGG - Intronic
1178140408 21:29676573-29676595 GGCTGGCATCCACACGAGAGAGG - Intronic
1180248511 21:46564135-46564157 GGTTGACCTAACCAAGAGAGGGG + Intronic
1180322789 22:11338437-11338459 TTTTTGCATCACTATGAGAGTGG + Intergenic
1181117197 22:20639588-20639610 GGATGGCATCACCCTGACTGTGG - Intergenic
950194406 3:10998987-10999009 GGTTGGCATCACCAAGACCTGGG - Intronic
952535419 3:34304315-34304337 GGGTGGGGTCACCATGAGGGTGG + Intergenic
955304258 3:57814150-57814172 GGATGGGTTCACCCTGAGAGAGG - Intronic
955786964 3:62551037-62551059 GGTTGGCATCACCATGAGAGAGG - Intronic
958686616 3:97406450-97406472 GATTGGTGTCACCATGGGAGTGG - Intronic
959115983 3:102178534-102178556 GGTTGGGATCACCAAAATAGTGG + Intronic
961205659 3:125079399-125079421 GGGTGGCATCAACATGAAAGGGG + Intergenic
961602368 3:128071815-128071837 GGTTGACATGACCATCAGAAGGG - Intronic
964912921 3:161803608-161803630 GGTAGGCTCCACCATGGGAGAGG + Intergenic
966496144 3:180583595-180583617 TGTTGGCATCTACATGAGTGGGG - Intergenic
966936819 3:184715976-184715998 GGTTGGAATCTTCTTGAGAGAGG + Intergenic
969178171 4:5415889-5415911 GGAAGGCATCACCAAGAGATGGG - Intronic
973651278 4:52999458-52999480 GGGAGGTATCAACATGAGAGGGG + Intronic
973712394 4:53642790-53642812 TGGTGCCATGACCATGAGAGGGG + Intronic
973865631 4:55110061-55110083 GGTGGGCAATTCCATGAGAGGGG + Intronic
973980881 4:56307270-56307292 TGTTGGGATCTCCATGAAAGAGG + Intronic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
975611057 4:76203803-76203825 GGAAGGCAACACCATGAGAGTGG + Intronic
977517866 4:98044958-98044980 GGTCTGCCTCACCATGAGACAGG + Intronic
977529088 4:98178949-98178971 ATTTGAAATCACCATGAGAGAGG + Intergenic
989020178 5:36996235-36996257 GATTGGCATCAAAATCAGAGTGG + Intronic
994183484 5:96793823-96793845 GCTTGGCATCACAATGACTGTGG - Exonic
995437900 5:112158537-112158559 GATTGGCAGCAGCATGAGAATGG - Intronic
996675597 5:126171769-126171791 GGTTGGCATGACCCATAGAGAGG + Intergenic
999366929 5:151029243-151029265 GGGTGGCATCTTCATGAGGGAGG + Intergenic
1005780598 6:29187520-29187542 GGTTAGCATCTCCATGATCGAGG + Intergenic
1006402601 6:33826480-33826502 CGTTGGCATCACCTGGAGACTGG + Intergenic
1007169672 6:39853732-39853754 GGATGACAGCACCATGAGGGAGG - Intronic
1011774809 6:90717748-90717770 AGGTGGCATCACCCTGAGAAGGG - Intergenic
1018908303 6:168087877-168087899 GGTTGGAAGCACCATGAGAGGGG - Intergenic
1023417629 7:39948146-39948168 GGTGGGCAACACCATGGGATGGG - Intergenic
1030587450 7:111437948-111437970 GGTTTGCATCACCACTAGGGAGG - Intronic
1030634270 7:111930989-111931011 GGTTTGCCTCAGCTTGAGAGAGG + Intronic
1031763567 7:125744940-125744962 TGTTGACATCACCAACAGAGAGG + Intergenic
1034116796 7:148590762-148590784 GATTGGCATCACCATAAGTAAGG - Exonic
1035643261 8:1199899-1199921 GGCTGTCATCACCAGGGGAGGGG - Intergenic
1037898911 8:22676155-22676177 GGATGGCAGCACCAGCAGAGGGG + Intergenic
1039167161 8:34696171-34696193 GGTTGGCATTACAATCATAGGGG + Intergenic
1039583868 8:38689018-38689040 GATTGGGATAAGCATGAGAGAGG + Intergenic
1048968037 8:139628232-139628254 TGGTGGCCTCACCATGAGGGAGG - Intronic
1053384884 9:37679060-37679082 AGATGGCAAGACCATGAGAGAGG - Intronic
1060135457 9:121149048-121149070 AGTAGGCATCACCATGGGAAGGG - Intronic
1062163046 9:135090184-135090206 GGTGGGCAGCACCTGGAGAGGGG - Exonic
1203370480 Un_KI270442v1:299017-299039 TTTTTGCATCACTATGAGAGTGG + Intergenic
1197970781 X:132112736-132112758 GGTTGGCATCAACATGGCTGTGG - Intronic