ID: 955787898

View in Genome Browser
Species Human (GRCh38)
Location 3:62559144-62559166
Sequence AAGTGTGTCAAATGCAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955787898_955787902 17 Left 955787898 3:62559144-62559166 CCTTCCTTGCATTTGACACACTT 0: 1
1: 0
2: 1
3: 18
4: 212
Right 955787902 3:62559184-62559206 TAATAGGTGGATTTACCTACTGG 0: 1
1: 0
2: 0
3: 2
4: 80
955787898_955787901 4 Left 955787898 3:62559144-62559166 CCTTCCTTGCATTTGACACACTT 0: 1
1: 0
2: 1
3: 18
4: 212
Right 955787901 3:62559171-62559193 ATATAGTATAGCTTAATAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 111
955787898_955787900 1 Left 955787898 3:62559144-62559166 CCTTCCTTGCATTTGACACACTT 0: 1
1: 0
2: 1
3: 18
4: 212
Right 955787900 3:62559168-62559190 CTAATATAGTATAGCTTAATAGG 0: 1
1: 0
2: 0
3: 3
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955787898 Original CRISPR AAGTGTGTCAAATGCAAGGA AGG (reversed) Intronic
901163301 1:7197218-7197240 GTGTGTGTCAAATGTGAGGATGG + Intronic
903630976 1:24770490-24770512 AAGTGAGCCAAAAGCAAGGGGGG - Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
905842906 1:41200053-41200075 AAGTGTTATTAATGCAAGGAAGG + Intronic
906076622 1:43056607-43056629 AAGTGTCTCAGATGAAAGGTTGG - Intergenic
907866411 1:58403634-58403656 TCATGTGTAAAATGCAAGGAAGG + Intronic
908139987 1:61174242-61174264 ATGTGTTTCAAAATCAAGGAAGG - Intronic
908145080 1:61233112-61233134 ATGTCTGTGAAAGGCAAGGAGGG - Intronic
909156282 1:72081483-72081505 AAATGTGGCAAGTGCAAAGAAGG - Intronic
911223406 1:95276970-95276992 AGGTCTGTCTAAAGCAAGGAGGG - Intergenic
911867156 1:103043320-103043342 ATGTGTGTCACATGTCAGGAAGG + Intronic
912089427 1:106052914-106052936 TAGTGATTCAAATTCAAGGAAGG - Intergenic
913457771 1:119051174-119051196 AAGGGTGTCGAATGGGAGGAGGG - Intronic
917577239 1:176336414-176336436 GAGTGTGGCAAATGGATGGAGGG + Intergenic
918200571 1:182262479-182262501 AAGTATGTGAAATGCCTGGATGG + Intergenic
919056295 1:192573590-192573612 AAGTGTGACAAGTGCATGGCAGG - Intergenic
919884500 1:201923276-201923298 CTGTGTGTCAAATTCCAGGATGG - Intronic
920025458 1:202991039-202991061 AAATGTGGCACATGCAATGAAGG - Intergenic
921320229 1:213931446-213931468 AGAAGTGTCTAATGCAAGGATGG - Intergenic
921559322 1:216638465-216638487 AAATGTGTCTAATGCAACTAAGG - Intronic
923451783 1:234124928-234124950 AAGTGTGTGCAATGCATGCATGG - Intronic
924136859 1:240976265-240976287 AAGAGTGTCAATAGCTAGGAAGG + Intronic
1063902339 10:10747417-10747439 AATTGTGGCAAGTGCAACGAAGG + Intergenic
1064822355 10:19351527-19351549 AAGTGTTTCAAGTACAAGAATGG + Intronic
1065371298 10:24989375-24989397 GAGTGGCTCAAAGGCAAGGACGG - Intronic
1066345829 10:34585774-34585796 AAGTATGTAAAATGAGAGGAAGG + Intronic
1066371828 10:34824154-34824176 TAGTGTGTCCAAAGCAAAGAGGG - Intergenic
1068003099 10:51359753-51359775 AGGTGTGTAAAAAGCAAGGAGGG + Intronic
1068023376 10:51612553-51612575 AAGTGTGTCATTTGTAAAGAGGG + Intronic
1068326329 10:55492452-55492474 AAGGGTAACAAATACAAGGAAGG + Intronic
1068491127 10:57725302-57725324 TAGTTTGTCATATGCAAAGATGG + Intergenic
1068940795 10:62678810-62678832 AATTATGTTAAATGCAATGAAGG - Intergenic
1069282490 10:66672383-66672405 CAGTGAGTCAAAAGGAAGGATGG - Intronic
1069456664 10:68559595-68559617 AATGGTGTGAAATGCAATGAGGG + Intergenic
1072377697 10:94835199-94835221 AAGTGTGTCAAAGGCACTGCAGG - Intronic
1072622196 10:97087418-97087440 CAATGTGACAAATGCAGGGATGG - Intronic
1076076984 10:127541596-127541618 AAGTCTGGCAAATTCCAGGATGG + Intergenic
1077766988 11:5169622-5169644 AAGTGTGGAAAATACAAGAATGG - Intronic
1082889809 11:58126866-58126888 CAATGTGTCAAAAGGAAGGAAGG - Intronic
1086766757 11:90705144-90705166 AAGTGTGGCAAGTACAATGATGG - Intergenic
1087011030 11:93514158-93514180 AAGTGGGGAAAATGGAAGGAGGG + Intronic
1087672367 11:101122884-101122906 AAGTGTGTGATATAAAAGGATGG - Intronic
1087970396 11:104474000-104474022 ATGTGTTACAAATGCAAGGTAGG + Intergenic
1088626883 11:111735958-111735980 AAGTGAAACAAATGCATGGAAGG + Intronic
1088709018 11:112489854-112489876 AAATGTGTCAAAAGGATGGATGG - Intergenic
1088926458 11:114307930-114307952 AAAACTGACAAATGCAAGGAAGG - Intronic
1089125350 11:116172726-116172748 AAGTGTTAGAAATGGAAGGAGGG + Intergenic
1089675485 11:120085822-120085844 AAGAGTCTCAAAATCAAGGAAGG - Intergenic
1090474922 11:127011285-127011307 ATGTTTGACAAATGCAGGGAAGG - Intergenic
1090876867 11:130798021-130798043 AAGTGGATCAAAAGAAAGGAAGG + Intergenic
1093276377 12:17133359-17133381 AATTGTATCAAGTGGAAGGATGG + Intergenic
1093447402 12:19275960-19275982 TAGTGTGACAAATACAATGAAGG + Intronic
1098302385 12:69067405-69067427 GTGAGTGTAAAATGCAAGGACGG + Intergenic
1098652901 12:72995976-72995998 AAGTGTGTCAAAAGCCTGGAAGG - Intergenic
1100856863 12:98764935-98764957 ATGTGTGTCTAATGCATGGCAGG + Intronic
1101949622 12:109164531-109164553 CTGTGTGTGAAATGCTAGGAAGG - Intronic
1102352280 12:112202684-112202706 AAGCTTCTCAAATACAAGGATGG + Intronic
1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG + Intronic
1107064178 13:36195139-36195161 AAATGTGTCCAATGCCAGGAAGG + Intronic
1107227042 13:38063801-38063823 AAGTGCATTAAATGCATGGAAGG + Intergenic
1108058564 13:46509689-46509711 CAGTGTGTCACATGGCAGGATGG - Intergenic
1108585754 13:51868283-51868305 AAATCTGGCAAATGCTAGGAGGG + Intergenic
1109073388 13:57800014-57800036 AAAGGTGACAAATGTAAGGAAGG - Intergenic
1112310161 13:98310998-98311020 AAGTTTGTGAAAGGCAAGGGAGG + Intronic
1115499314 14:34035321-34035343 AAGTGTGTAAAGTGCAAGCCTGG - Intronic
1118176395 14:63444362-63444384 AAGTCTGTACAAGGCAAGGAAGG - Intronic
1121452924 14:94020847-94020869 AACTGTGAGAAATGCTAGGATGG + Intergenic
1121768051 14:96504399-96504421 AAGTGTGTAAAATGGAAGACGGG + Intronic
1122320903 14:100855223-100855245 AAGTAGGCCAAATGCATGGATGG - Intergenic
1124382210 15:29176588-29176610 AAGTGTGGCACATGCAGGGCAGG + Intronic
1127537624 15:59904654-59904676 AAGGGTGTCAAGTGCAGGCATGG + Intergenic
1127878518 15:63133988-63134010 AGTTGTGTCAAATGTTAGGAGGG + Intronic
1128545660 15:68566030-68566052 CAGTGTGCAAAATGCAAAGATGG - Intergenic
1129011736 15:72424606-72424628 AATTGTGTTAAATGCTAAGAAGG + Intergenic
1130369076 15:83268147-83268169 CAGTGTGACCAATGCAAGCATGG - Exonic
1132097073 15:98994670-98994692 GACAGTGTGAAATGCAAGGAGGG - Intronic
1133543411 16:6779178-6779200 ATGTTTACCAAATGCAAGGAAGG - Intronic
1134513837 16:14870730-14870752 AATTGTGGCACATGCAAGAAGGG - Intronic
1134701480 16:16269225-16269247 AATTGTGGCACATGCAAGAAGGG - Intronic
1134970351 16:18525420-18525442 AATTGTGGCACATGCAAGAAGGG + Intronic
1136029314 16:27491389-27491411 ATGTGGATCAAATGCATGGAGGG - Intronic
1137996496 16:53220523-53220545 AAGGAAGTGAAATGCAAGGAAGG - Intronic
1138173003 16:54870537-54870559 AACTCTTTCAAATGCAAAGAAGG + Intergenic
1138392648 16:56681918-56681940 AAGAGTGGAGAATGCAAGGACGG + Intronic
1140769821 16:78193224-78193246 AAGTGAGGCAAAGGCAGGGAGGG + Intronic
1140981110 16:80110383-80110405 AAATGTGGCAAATGCAACCATGG - Intergenic
1141457828 16:84155849-84155871 AAGTGTGAAAAAGGGAAGGAAGG - Intronic
1141817268 16:86420489-86420511 AAGTCTGTCAGATGAAAGAATGG + Intergenic
1143234225 17:5384124-5384146 AAATGTGTCAAATACAAAAATGG + Exonic
1146393081 17:32440768-32440790 GACTGTGTTAAATGCTAGGAAGG + Intergenic
1146526518 17:33571597-33571619 AAATGTGTGAAATGCTATGAAGG + Intronic
1146984501 17:37202096-37202118 AAATGTGTCGAAGGAAAGGAGGG + Intronic
1148475342 17:47925062-47925084 ACGTGTCCCAACTGCAAGGATGG + Exonic
1150252306 17:63713371-63713393 GAGTGTGTCACATGGAGGGAGGG - Intronic
1153203102 18:2666666-2666688 GAGTGTTTCAAATGAATGGAAGG + Intronic
1154227665 18:12522092-12522114 AAGGATGTCAAAAGCAAAGATGG + Intronic
1154347193 18:13551939-13551961 CAGTGTGTCACATGGCAGGATGG + Intronic
1156733178 18:40221227-40221249 AAATGTGGCAAAAGAAAGGAAGG + Intergenic
1157832120 18:50866116-50866138 ATGTGGTTCAAGTGCAAGGAAGG + Intergenic
1157943154 18:51951162-51951184 AAGTGTGTCAAAAGTTAGGCTGG - Intergenic
1157950401 18:52030086-52030108 AAGTGTGGAAGATGAAAGGAAGG + Intergenic
1159642093 18:70875656-70875678 AAGTTTGAGAAATTCAAGGATGG + Intergenic
1159858964 18:73624151-73624173 AAGTGTGGCAAAAGCAATAAAGG + Intergenic
1165998247 19:39860916-39860938 AAGTGTGACAAAGGCTAAGAAGG + Intergenic
1167060998 19:47146275-47146297 AAGAGTTTCAAATGACAGGAAGG + Intronic
925765791 2:7234145-7234167 AAGTGTGTCCAAAACAAGAAGGG + Intergenic
926202998 2:10814552-10814574 AAATGTGTCAAATGCAGGAAAGG - Intronic
928148060 2:28799379-28799401 AAGGGTGTCAAATGGCTGGATGG - Exonic
929570007 2:43016745-43016767 AAGTGTGTCACATGGCAAGAAGG - Intergenic
929820792 2:45271898-45271920 AAGTGTGTTAGATACGAGGAGGG - Intergenic
931149203 2:59554220-59554242 CATTGTGTTAAATGCAAAGAAGG - Intergenic
932099823 2:68888692-68888714 GAGTGGGGCAGATGCAAGGAAGG - Intergenic
933280412 2:80326884-80326906 AAGTGTGTAAAAGGGAAGGAGGG - Intronic
933501879 2:83123181-83123203 AAGTGTGGCACATACAAAGATGG + Intergenic
935156285 2:100486401-100486423 ATGTGTGTTCAATGCAAGGAGGG + Intergenic
935218692 2:100994050-100994072 AAGTATGTCAAAAGCAGGGAGGG + Intronic
938878999 2:135565273-135565295 AATTTTGCCAAGTGCAAGGAGGG - Intronic
939111035 2:138007768-138007790 AAATCTGTCAAAAGCAAGAATGG - Intronic
939887918 2:147701338-147701360 ATGTCTCCCAAATGCAAGGAGGG + Intergenic
940236799 2:151520149-151520171 AAGTCTGTGAAATCCAAAGAAGG + Intronic
944937293 2:204582637-204582659 GAGTGGGAGAAATGCAAGGAGGG - Intronic
945149014 2:206768315-206768337 AATGGTGCCAAATGTAAGGAAGG + Intronic
945615751 2:212063948-212063970 ATGTCTGTAAAATGCAAAGAGGG - Intronic
947387937 2:229610787-229610809 AAGTCTGTCAAATGCCAATATGG + Intronic
1171182829 20:23103472-23103494 AAATGACTCAAATGCCAGGAAGG + Intergenic
1172659138 20:36555441-36555463 CAGTGTGTCATATGCAAGTGAGG + Intergenic
1174168616 20:48602364-48602386 AAGTGTGTCGAATGCAAATAGGG - Intergenic
1174462222 20:50691164-50691186 AAGTGAGGCAGCTGCAAGGAGGG - Exonic
1174800740 20:53561044-53561066 AAGACTGTCAAAAACAAGGAAGG + Intergenic
1177303161 21:19276990-19277012 AAGTTTATCAAACCCAAGGAGGG - Intergenic
1177721439 21:24912073-24912095 AAGTTTGTAAAATGTAAGCAGGG + Intergenic
1177909270 21:27010685-27010707 AAGAGAGTCTAATGCAATGAAGG - Intergenic
1180657008 22:17430381-17430403 AAGTGTGCCAGATGGAAGGATGG - Intronic
1182186820 22:28412627-28412649 AATTTTGTCAAATGGAAGAAGGG - Intronic
1183540881 22:38428696-38428718 AAATGTGGCTCATGCAAGGAAGG - Intronic
951832081 3:26942452-26942474 CAGTGGGTCCAATGCATGGAGGG + Intergenic
953951363 3:47192919-47192941 AAGTGTGTGAAATGCATGGGGGG - Intergenic
955051580 3:55415987-55416009 AAATGAGTAAAATGCATGGATGG - Intergenic
955487881 3:59452968-59452990 CAGTTTGTCAAATGCAAAAATGG + Intergenic
955787898 3:62559144-62559166 AAGTGTGTCAAATGCAAGGAAGG - Intronic
956904174 3:73748834-73748856 CAATGTGACAAATGCCAGGATGG - Intergenic
958505811 3:94975451-94975473 ATGTATGTCAAAAGCAAGCAGGG + Intergenic
961097502 3:124170207-124170229 AAGTTTGTGAGATGCCAGGAAGG - Intronic
961359741 3:126359524-126359546 AAATGTGTGAAATTCAAGCATGG - Intergenic
961385679 3:126522074-126522096 AAGTGTGTCCGGTGCAAGGAGGG - Intergenic
962109225 3:132425592-132425614 GAGTCTGTAAAATGCAAGAACGG - Intronic
962969072 3:140382174-140382196 AACTGTGTTAAATGTTAGGATGG - Intronic
963360560 3:144267543-144267565 AAAGGTGTCAAATTAAAGGAAGG - Intergenic
963791466 3:149587060-149587082 AAATGGATCAAATCCAAGGAGGG + Intronic
964004665 3:151812835-151812857 AAGAGTGTGAAATGCCAGGATGG - Intergenic
964078915 3:152727125-152727147 AAGTGTGTCACATGTAAGAGAGG + Intergenic
967629352 3:191726233-191726255 AAGTGAGTCTATTTCAAGGATGG - Intergenic
973630297 4:52813952-52813974 AAGAGTGTTAAAGTCAAGGAAGG + Intergenic
975258431 4:72267990-72268012 AAGTGTCTAAGATGTAAGGAAGG + Intergenic
975382531 4:73717976-73717998 AAGTGTGTCAGATTCATGGTTGG + Intergenic
980117028 4:128689136-128689158 AAGAATGTAAAATGCAATGATGG - Intergenic
980864464 4:138538542-138538564 CAGTGTGCCAAATGCAAGCATGG + Intergenic
981751098 4:148092900-148092922 CAATGAGTCAAATGCAATGATGG + Intronic
982349207 4:154396390-154396412 AATTTTGTCTAATGCAAGGGTGG + Intronic
983927557 4:173418156-173418178 AAGTATGGAAAAGGCAAGGAAGG - Intergenic
984024811 4:174530268-174530290 AAGTATGACAAATGCAAAAATGG - Intergenic
984668564 4:182455504-182455526 AACTCTGTGAGATGCAAGGAAGG - Intronic
986075665 5:4335444-4335466 AAGTATGTCAGGTGCCAGGATGG + Intergenic
986818612 5:11440086-11440108 AAGTGTGTTAATTACAGGGAGGG - Intronic
987600453 5:20061943-20061965 CAGTGTGTGACATGCAATGAGGG - Intronic
989130396 5:38101242-38101264 AAGTGTGTGAAAGGCATGTATGG + Intergenic
990291004 5:54351630-54351652 AAGGGAGTCAAATGCCAAGATGG - Intergenic
990544419 5:56808073-56808095 AAGTGGCTCCAATGCAAGGCAGG + Intergenic
990978384 5:61579081-61579103 AAGTGAGTAAAGTGAAAGGATGG - Intergenic
991453091 5:66773437-66773459 CAATGAGTTAAATGCAAGGAGGG - Intronic
992003448 5:72456399-72456421 AAGCCTTTCAAATGCAAGGTGGG - Exonic
992674035 5:79087881-79087903 AAGTATGTGAAATGTAAGGCTGG + Intronic
994001167 5:94781413-94781435 AAGTGTGTTAAATGATATGAAGG - Intronic
994726337 5:103440674-103440696 AAGAGTGTCATATGGAAGAAAGG + Intergenic
995368281 5:111388490-111388512 AAATTTTTCAGATGCAAGGAGGG - Intronic
995718688 5:115106274-115106296 AAGAGTGCCAAATGCAAAGCTGG + Intergenic
996155231 5:120090989-120091011 AAGTGTGACAAATGCCAGGAAGG + Intergenic
997472343 5:134123978-134124000 ATGAGGGTCAAATGGAAGGATGG - Intronic
998841268 5:146256857-146256879 AAGTGTGTCATATTAAAGGAAGG - Intronic
1000652839 5:163838083-163838105 AAGTGTGCCAAGCGCAAGGATGG + Intergenic
1001135413 5:169098670-169098692 AAATGTGTCAAATGACAGGAGGG + Intronic
1002036896 5:176478024-176478046 ACATTTGTCAAATGAAAGGATGG + Intronic
1003709272 6:8570798-8570820 AACTGTGGCAGATGCATGGATGG + Intergenic
1005036022 6:21555556-21555578 AAGTGGGTGAAAGGGAAGGATGG + Intergenic
1007147082 6:39646830-39646852 AACTGTGTGAAAGGCAAGTATGG - Intronic
1007995803 6:46306450-46306472 AACTGTGTAGAATGCTAGGAGGG - Intronic
1009850071 6:69184981-69185003 ATGTGTGTCTAATGCACGGATGG - Intronic
1011544695 6:88470387-88470409 AAATTAATCAAATGCAAGGAGGG + Intergenic
1012569644 6:100707913-100707935 AAGGCTGTCATATGAAAGGAAGG - Intronic
1012724335 6:102789846-102789868 AAGTGTTTCAAATACACGAATGG + Intergenic
1013604732 6:111737405-111737427 AAATGAGTCAAACCCAAGGAGGG - Intronic
1013880836 6:114898359-114898381 AACTGTTTCAAATTCAAGGGAGG + Intergenic
1014062185 6:117084295-117084317 AAGTATCTCGAATGTAAGGAAGG - Intergenic
1016312276 6:142746791-142746813 AAATCTGTTAAAAGCAAGGATGG - Intergenic
1018058828 6:160073978-160074000 AAGTATGACAAATCCAAGGGTGG + Intronic
1018504497 6:164450300-164450322 AAGTGACTCAAAAACAAGGATGG - Intergenic
1022691033 7:32654775-32654797 GAGTGTATAAAATGCATGGAAGG + Intergenic
1022918600 7:34988668-34988690 GAGTGTATAAAATGCATGGAAGG + Intronic
1023331259 7:39119470-39119492 GAGAGAGTCAAATGGAAGGATGG + Intronic
1023362319 7:39429547-39429569 CACTGTGTCAAATGCCATGAAGG - Intronic
1024969078 7:55052268-55052290 ATGTGTGTCTCATGCAAGGCAGG - Intronic
1026771855 7:73207273-73207295 TAGTGTGTGAAAGGCATGGATGG - Intergenic
1027012723 7:74760669-74760691 TAGTGTGTGAAAGGCATGGATGG - Intronic
1027075317 7:75185384-75185406 TAGTGTGTGAAAGGCATGGATGG + Intergenic
1027523446 7:79237760-79237782 CATTGTGGCATATGCAAGGATGG - Intronic
1027962920 7:84969786-84969808 AACTGTGTTAAAGGCAAGAAAGG - Intergenic
1029455197 7:100666617-100666639 AAGTTGGCCAGATGCAAGGAAGG - Intergenic
1030670640 7:112332139-112332161 AAGTGTTTCAAAAGAAAGTAAGG + Intronic
1032351766 7:131171119-131171141 AAGTGTTTGAAATCCAAGGCAGG + Intronic
1032378875 7:131454696-131454718 AATTGTGTCACATGGGAGGAAGG - Intronic
1032516805 7:132512526-132512548 TAGTGTGTAAAATGAAAGGCTGG - Intronic
1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG + Intronic
1035390015 7:158497446-158497468 GAGTGTGGCCAAGGCAAGGAAGG - Intronic
1035692146 8:1567243-1567265 AAGTGTGCCAAATAAAAGGTGGG - Intronic
1040594594 8:48825186-48825208 AAGAGTGGTAAATCCAAGGAAGG - Intergenic
1042344516 8:67713694-67713716 CACTGTGTCAAATGCTATGATGG - Intronic
1042589115 8:70378481-70378503 AAGTATGCAAAATGCAGGGAAGG + Intronic
1044589305 8:93898406-93898428 AACTGTGTCAAAACCAGGGAAGG - Intronic
1045978861 8:108160760-108160782 AAGTGTGTAGAAAGGAAGGATGG + Intergenic
1048559711 8:135520733-135520755 ATATGTGTCACATGCAAGGAGGG + Intronic
1049810850 8:144569792-144569814 AAGTGTGTCAACTTTATGGAAGG - Intronic
1053164639 9:35835772-35835794 AAGTGAGGCAAAGGCCAGGATGG - Intronic
1054733610 9:68727794-68727816 CAGTGTGTCTCATGGAAGGAAGG + Intronic
1059803395 9:117773328-117773350 AAGACTGTCCAAGGCAAGGATGG + Intergenic
1187824370 X:23319856-23319878 AAGAGTGTCAAATGGAAGCTTGG + Intergenic
1188004728 X:25009407-25009429 AAATGTGTCAACAGAAAGGAGGG + Intronic
1189235596 X:39484628-39484650 AAGTGTGTCAAAAGCAGCAAAGG - Intergenic
1193815478 X:86100423-86100445 ATGTGTGTAAAAAGAAAGGAAGG - Intergenic
1196376100 X:115034214-115034236 AGGTGTGTCACATGCAAGAGAGG - Intergenic
1196748870 X:119096629-119096651 AAGTGTGGCAAATGCAGTCAAGG + Exonic
1198971181 X:142282205-142282227 AAGTATGTGAAATGCATGCAAGG - Intergenic
1201638832 Y:16156518-16156540 AATTGTGTCTAATACAAAGAAGG + Intergenic