ID: 955790594

View in Genome Browser
Species Human (GRCh38)
Location 3:62585147-62585169
Sequence GTGTGTCCAAAACTGCTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955790594 Original CRISPR GTGTGTCCAAAACTGCTAGT TGG Intronic
904724313 1:32535337-32535359 GTGTGTCCAAGACAGGTAGGAGG - Intronic
910498626 1:87862845-87862867 CTCTGTCCATAACTGCCAGTGGG + Intergenic
923240894 1:232084493-232084515 GTGTGAACAAACCTGCTAGCAGG - Intergenic
923457857 1:234180500-234180522 GTGTGTTCTAAAGTCCTAGTGGG - Intronic
923772374 1:236948746-236948768 TTCTGTCCAAAACTGCTACAAGG - Intergenic
924760332 1:246978826-246978848 GTGTTTCCAAAGCTGCTTGTCGG + Intronic
924873797 1:248078159-248078181 GTATTTCAAAAATTGCTAGTAGG + Intronic
1071933087 10:90496095-90496117 GTGTGTCCTAAACTCCTTCTGGG + Intergenic
1078169948 11:8922083-8922105 GTGTCTTCTAAACTGCCAGTAGG + Intronic
1085572052 11:77568418-77568440 GTGTGTCCAAAGATGCCACTGGG + Intronic
1095074931 12:37907720-37907742 GTGTTTCAAAAACTGCTTGAAGG + Intergenic
1095922014 12:47541225-47541247 GTGTTTTCAAAACTGTTAGAGGG + Intergenic
1096992499 12:55816659-55816681 GTTTGTCCAAAACATCTAATGGG + Intronic
1099475255 12:83100529-83100551 GTATGTCCAAAATGGCAAGTGGG - Intronic
1099793020 12:87361210-87361232 ATCTGTCCAAAACTGACAGTGGG + Intergenic
1100074396 12:90761503-90761525 GTGTTTCCAAAACTGGTGATGGG + Intergenic
1102696707 12:114805485-114805507 CTGTGTCCCAAACTTCCAGTGGG - Intergenic
1107880367 13:44827128-44827150 GTGGTTCCAATACTGCTGGTAGG - Intergenic
1111253251 13:85633121-85633143 GAGTGTCCAAAAGTGCCAGCTGG - Intergenic
1117987274 14:61399528-61399550 GTGAGTCAAAAACTGCAGGTAGG + Intronic
1120838363 14:89061277-89061299 GTGTGTCCAAAACTGACAATAGG + Intergenic
1121621516 14:95352791-95352813 GGGTGTCCAGCACTGCTGGTGGG - Intergenic
1125344829 15:38708696-38708718 GTATTTCTAAAACTGCTTGTGGG - Intergenic
1126210466 15:46095393-46095415 GTGAGTACAAAAATGCTGGTCGG + Intergenic
1127022553 15:54764966-54764988 GTCTGTCCAATGCTGCAAGTGGG - Intergenic
1144931822 17:18865204-18865226 GTGTGACCAAAACTGTCATTTGG + Intronic
1152773390 17:82184801-82184823 ATGTGTCCAAAACTGTTGGCAGG - Intronic
1155090375 18:22503489-22503511 GTTTTTCCAAAACTGCTGATAGG - Intergenic
1155410506 18:25539628-25539650 ATTTGTACAAAACTGCTGGTAGG + Intergenic
1156570153 18:38243683-38243705 GGGTGTCCAAAGTTGCTAGGAGG - Intergenic
1158806721 18:60982758-60982780 ATGTGTCAAAAAATGCTAATTGG + Intergenic
1159716608 18:71831696-71831718 GTGTCTCCAAAACTAATAGCTGG + Intergenic
1167427324 19:49436224-49436246 GCGTGAGCAAAATTGCTAGTAGG + Intronic
927677716 2:25118628-25118650 GTATGTCAAAAACAGCAAGTTGG + Intronic
931979452 2:67678574-67678596 ATGTGTACAAAATTGCTAGAGGG + Intergenic
932102562 2:68913963-68913985 CTGTGTCAAAGACTGCTCGTTGG + Intergenic
932171418 2:69560492-69560514 GTGTTTCAAAAAATGCCAGTAGG - Intronic
933201182 2:79450897-79450919 TTATGTCCTAAACTGCTAGATGG - Intronic
935217765 2:100988324-100988346 GTATGTCCCAAACTGCAAGAGGG - Intronic
940025516 2:149202979-149203001 CTGTATCCAAAACTGCTATTTGG - Intronic
943660177 2:190551745-190551767 GTCTTTCCATAACTGTTAGTAGG + Intergenic
943800431 2:192050848-192050870 GTGTGTCCAAATCTGAAAGTTGG - Intronic
945878765 2:215305342-215305364 GTGTGTCAAATACTGCCAGCAGG - Intergenic
1169978942 20:11362122-11362144 GTCTGTCCAATATTGATAGTAGG + Intergenic
1172477381 20:35249027-35249049 GTGTGGGCAGAACTGCAAGTGGG - Intronic
1174152484 20:48495260-48495282 GTGCTTCCAAATGTGCTAGTTGG + Intergenic
1177960443 21:27660120-27660142 GTGTTTGCAAAAATGCTAGTAGG - Intergenic
952863270 3:37832690-37832712 GTGTGTCCAGGACTGGCAGTGGG + Intergenic
955790594 3:62585147-62585169 GTGTGTCCAAAACTGCTAGTTGG + Intronic
958015601 3:87936782-87936804 GTGTGTGTAAATCTCCTAGTGGG - Intergenic
964179891 3:153870404-153870426 ATCTGTCCAATACTGATAGTAGG - Intergenic
965829564 3:172769274-172769296 GTGTGACAAAAACTGCTGTTAGG + Intronic
969856035 4:10000594-10000616 ATGTAGCCAAAACTGCTACTAGG - Intronic
973134814 4:46693929-46693951 GTATTTCCAAAACTGCTCGATGG + Intergenic
975978511 4:80127513-80127535 GTGTGAACAAGACTGCCAGTAGG - Intergenic
979129013 4:117016196-117016218 GTCTGTCCAATACTGAAAGTGGG - Intergenic
979851644 4:125578503-125578525 GTGTGTAAAAAGCTGCAAGTCGG - Intergenic
986658148 5:10035410-10035432 GGGTTTCAAAACCTGCTAGTAGG - Intergenic
990728530 5:58783688-58783710 ATGTGCCCAAAACTGCCTGTAGG - Intronic
992919740 5:81502246-81502268 CTGTGTCCAATACTGCTGATAGG - Intronic
995110154 5:108419960-108419982 TTTTGTCCAAAACTGAAAGTTGG - Intergenic
995375484 5:111469536-111469558 GTGTGTCACAAACTGCTTTTTGG - Intronic
995775243 5:115718009-115718031 TTGTGTCCAAAATGGCTACTTGG - Intergenic
997339292 5:133130224-133130246 GTTTGGCCAAAACTGCTTGGCGG - Intergenic
997800657 5:136857702-136857724 GTGTTTCCAAAAATTCAAGTTGG - Intergenic
1003162847 6:3650888-3650910 TAGTGTCCCAAACTGCCAGTTGG + Intergenic
1007810573 6:44482924-44482946 GTGTGTGCCCAACTGCTTGTTGG + Intergenic
1007825642 6:44598810-44598832 GTGTATCCAGAACTGAAAGTCGG + Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1009519825 6:64667390-64667412 TTGTGTCCAAAGCTGCAAGGAGG - Intronic
1012841838 6:104338766-104338788 GAGTTTCCAAAACTGCTGCTGGG + Intergenic
1014241199 6:119019465-119019487 GTATGTCCAAAACTCCCACTTGG + Intronic
1015912209 6:138180203-138180225 GTGTGCCAAAAACAGCTATTGGG - Intronic
1018021666 6:159766919-159766941 GTGTGTGGAAAATTGCCAGTTGG - Intronic
1020714512 7:11653686-11653708 GTGTGTACAAAACTGATTGCTGG - Intronic
1023241221 7:38149675-38149697 ATCTGTCCAATACTGATAGTGGG - Intergenic
1030270999 7:107668065-107668087 GTGTGACCACAAGTGCTAGATGG - Intronic
1032763345 7:134965755-134965777 GTGTTTCCAAAACTGCTTTCTGG + Intronic
1035040373 7:155922314-155922336 GTGTGTCCAAAAATGCCTGTGGG + Intergenic
1039404254 8:37299100-37299122 GTGTGACCAAAACTGCTCTTTGG - Intergenic
1041159617 8:55026173-55026195 TTGTGTCCAAAAATGCTTGAAGG + Intergenic
1043133802 8:76495592-76495614 GTCTGTCCAATAATGCAAGTTGG + Intergenic
1045857436 8:106780680-106780702 ATGTGTCCAATACTGCTGATAGG - Intergenic
1050958267 9:11692611-11692633 TTGTGTCCAAGACAGCCAGTAGG + Intergenic
1051845709 9:21449238-21449260 GTGCCTCCAAACCTGCTACTGGG - Intergenic
1058587784 9:106529066-106529088 GTTTGTCCCTAAATGCTAGTTGG + Intergenic
1061711827 9:132493212-132493234 GAGTGTCCAAATCTGCTTCTTGG + Intronic
1188451647 X:30313491-30313513 GTTTGTCCACAACTGCAATTTGG + Intergenic
1189703504 X:43736040-43736062 GTGTGTCCAAAACCCCTGCTAGG - Intronic
1191747327 X:64503436-64503458 GTCTGTCTAAAACAGTTAGTAGG - Intergenic
1192866163 X:75134392-75134414 GTCTGCCCAATACTGCCAGTGGG - Intronic
1198832062 X:140761135-140761157 GTGTGTCCAAAACTACAAGGAGG - Intergenic