ID: 955791352

View in Genome Browser
Species Human (GRCh38)
Location 3:62591601-62591623
Sequence GTTCAGATTTTACCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955791351_955791352 -10 Left 955791351 3:62591588-62591610 CCAAATTAAACGAGTTCAGATTT 0: 1
1: 0
2: 0
3: 11
4: 165
Right 955791352 3:62591601-62591623 GTTCAGATTTTACCACAAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955791352 Original CRISPR GTTCAGATTTTACCACAAGC AGG Intronic
908718017 1:67090762-67090784 ATTCAGATTTTAACCCAAGGTGG - Intergenic
909327653 1:74371832-74371854 GTTGATATTTTACCAGATGCTGG - Intronic
909656296 1:78037134-78037156 GTTGTAATTTTACCAGAAGCAGG - Intronic
910272421 1:85410876-85410898 GTTCATATTCCACCAGAAGCAGG - Intronic
910927507 1:92411871-92411893 AATCAAGTTTTACCACAAGCCGG + Intergenic
912467673 1:109885240-109885262 GTTCAGATTCTTCAAGAAGCTGG - Intergenic
921313329 1:213867301-213867323 ACTCAGATATTCCCACAAGCAGG - Intergenic
921426521 1:215008228-215008250 GTTTAGATCCTCCCACAAGCAGG + Intronic
922590103 1:226769080-226769102 GGTTAGATTTTAAAACAAGCAGG - Intergenic
922647018 1:227297757-227297779 GATCAGAAGTTACCACAAACTGG + Intronic
924831606 1:247601531-247601553 GCTAACATTTTACAACAAGCAGG + Intergenic
1062959151 10:1559577-1559599 GTTCAGATTTTGACACAAGACGG + Intronic
1067271292 10:44793524-44793546 GTACACATTTTCCCAAAAGCAGG + Intergenic
1071053407 10:81479051-81479073 ATTCAGATTTTACCAGTAACAGG - Intergenic
1071328260 10:84537607-84537629 TTTCAGATTTTACCACTAGATGG - Intergenic
1072182777 10:93003841-93003863 GATAAGATTTCACCAAAAGCAGG + Intronic
1072455631 10:95573391-95573413 GATCAGATTTTGCCTAAAGCTGG - Intergenic
1074099937 10:110346887-110346909 GCTCAAATTGTACCAGAAGCTGG - Intergenic
1074579793 10:114708201-114708223 TTTCAGAATGTACCAGAAGCTGG - Intergenic
1079289125 11:19170898-19170920 GTTCTGATTTTGCCACACACTGG - Intronic
1084210128 11:67616958-67616980 ATTCAGATTTTATTCCAAGCAGG - Intergenic
1085881508 11:80472678-80472700 GTTTCAATTTTACCACAATCAGG - Intergenic
1088349655 11:108871403-108871425 ATTCAGATTTTTCTACCAGCAGG - Intronic
1090104512 11:123837844-123837866 GTTCAGATGTTTCCTCAAGTAGG - Intergenic
1090140839 11:124258721-124258743 GGTCAGCATTTGCCACAAGCTGG - Intergenic
1091175164 11:133551195-133551217 GTCAACATTTCACCACAAGCCGG - Intergenic
1092142859 12:6195832-6195854 GTTCAAATCTTACCACCAGGGGG + Intergenic
1092605437 12:10112931-10112953 GTCCTGATTTTGCCACAACCTGG + Intergenic
1101413636 12:104489945-104489967 GACCAGATTCTACCTCAAGCAGG + Intronic
1103286683 12:119807950-119807972 GTTCTGATGTTACCTCAAACAGG - Intronic
1108690216 13:52852722-52852744 GATCAGATTTGAACCCAAGCAGG - Intergenic
1110647039 13:77899502-77899524 GTTCAGAATCTACCAAAAACAGG + Intronic
1111238384 13:85439952-85439974 GTTAAGATTTTACCATAAAATGG + Intergenic
1112716548 13:102192552-102192574 TTTCACATTTTACCATAAACAGG + Intronic
1113285121 13:108837655-108837677 AATCAGATTTTACCTCAAGTTGG - Intronic
1114354231 14:21889700-21889722 GTTCAGACTTTACCCCAAAATGG - Intergenic
1120280888 14:82436502-82436524 CTTCACCTTTTATCACAAGCTGG - Intergenic
1121911559 14:97796737-97796759 GTTTAGATTTTGCCACTAGAAGG - Intergenic
1125314469 15:38416539-38416561 GTTCAGATTGTCCCTCAAGAAGG - Intergenic
1126856620 15:52845555-52845577 GTTCTGACTTTACCACTAACTGG + Intergenic
1134436404 16:14262509-14262531 GGTCAGATTGTGCCACAAGGTGG + Exonic
1137068114 16:35872257-35872279 GATCAGAAGTTACCACAGGCTGG + Intergenic
1141890786 16:86925298-86925320 ATTAAGAATTTACAACAAGCTGG - Intergenic
1142142687 16:88479585-88479607 ATTCAGACTTTCCCACCAGCTGG - Intronic
1143901730 17:10179528-10179550 GGTCACATTTTATCACATGCAGG + Intronic
1147019794 17:37522018-37522040 CTTCAGATCTCTCCACAAGCAGG - Intronic
1157070286 18:44399548-44399570 CTTCACATTTTACCTGAAGCTGG + Intergenic
1164331483 19:24262605-24262627 GTGCAGATTCTACCAAAAGAGGG + Intergenic
1164356721 19:27442942-27442964 TTTCAGATTCTACCAAAAGATGG - Intergenic
926411299 2:12605356-12605378 GTTCAGATCTTACAACATGCAGG + Intergenic
927968523 2:27288080-27288102 GCTCAGCTTTTACCAAAACCTGG + Intronic
929480177 2:42298999-42299021 GTTCTGATGTTACCACGAGAGGG - Intronic
932282471 2:70505952-70505974 GCTCAGATGTCCCCACAAGCAGG - Intronic
932505585 2:72228078-72228100 GTTCGGATTTTACCAGGAGAAGG + Intronic
933379447 2:81524260-81524282 GTTCAGCTTTTACCACTTCCTGG - Intergenic
934335516 2:92128864-92128886 TTGCAGATTTTACCAAAAGAGGG - Intergenic
934414495 2:93443538-93443560 TTGCAGATTTTACCAAAAGAGGG - Intergenic
936541027 2:113351524-113351546 GTGCAAATTTCACCACAATCAGG + Intergenic
938588947 2:132718992-132719014 GTTCAGACTTTACCCCCAGCAGG - Intronic
942459195 2:176158015-176158037 GTTGAAATTTTACCCCAGGCAGG + Intronic
946516510 2:220417398-220417420 GTTGATATTTTCCCAAAAGCTGG + Intergenic
948485317 2:238277156-238277178 GTTCAGATTTTGCCATCATCAGG + Exonic
1170199011 20:13722171-13722193 TTTCAGATTTTATAACAACCTGG + Intronic
1171233246 20:23504390-23504412 GTTCAGCTTTTGCTACAAGCAGG - Intergenic
1174836155 20:53857052-53857074 ATTCTGATTCTACCACAAGCTGG + Intergenic
1174850888 20:53993543-53993565 GTTCAGTTTTGACCACATTCTGG + Intronic
1183935917 22:41262173-41262195 GTTAGGTTTTTACCACCAGCAGG - Intronic
1184825559 22:46948429-46948451 TTTGAGATTTTCCCACATGCTGG + Intronic
1202718298 2_KI270715v1_random:37329-37351 TTGCAGATTTTACCAAAAGAGGG - Intergenic
1202718806 2_KI270715v1_random:45310-45332 TTGCAGATTTTACCAAAAGAGGG - Intergenic
955508937 3:59659959-59659981 CTTCAGATTTTGCAACAGGCTGG + Intergenic
955791352 3:62591601-62591623 GTTCAGATTTTACCACAAGCAGG + Intronic
956335769 3:68161741-68161763 GTTCATATTTTTCCTCAAGCTGG + Intronic
961753773 3:129114407-129114429 GTTCAGACTTTGCCACAAATGGG + Intronic
961991113 3:131192295-131192317 GTTCCAATTTCACCACATGCTGG - Intronic
964013333 3:151917178-151917200 GGTCAGATTTTGCCCCTAGCAGG - Intergenic
970942364 4:21649902-21649924 GGTCATATTTTATCACAGGCAGG + Intronic
971033119 4:22662694-22662716 GTTCAAATTGTCCCACAGGCTGG - Intergenic
971641085 4:29134056-29134078 GTTTAGATTTCTCCAAAAGCAGG - Intergenic
971963536 4:33520712-33520734 TTTCAGATTATATCACAAGATGG + Intergenic
973913566 4:55609533-55609555 ATACAGATTTTGCTACAAGCTGG - Intronic
974328587 4:60446744-60446766 GTTCAGTATTTACTATAAGCTGG - Intergenic
975926119 4:79455883-79455905 GTTTAGATTCTCCCAGAAGCAGG + Intergenic
977065465 4:92307533-92307555 CTTCAGTTTTTACCTCATGCCGG + Intronic
982182450 4:152761730-152761752 ATTCAGCTTTTACCACAAAATGG - Intronic
982276596 4:153642049-153642071 GACCAAATTTTCCCACAAGCGGG + Intergenic
982713501 4:158782434-158782456 GTACAGATTTTGCCATAGGCTGG - Intronic
983429811 4:167634366-167634388 ATTCAGAATTTCCAACAAGCTGG - Intergenic
984099663 4:175470048-175470070 GTTCTGATTTTACCACACACAGG - Intergenic
986344213 5:6819364-6819386 GTTGAGATTATTCCACAAGGGGG - Intergenic
987489780 5:18564302-18564324 GTTCAGCCTTTATTACAAGCAGG - Intergenic
988729207 5:33953509-33953531 GTTCAGATTTTGTCACCACCAGG + Intronic
995990639 5:118234651-118234673 AGTCAGATTATAACACAAGCAGG + Intergenic
995992584 5:118260603-118260625 GTTCAGTTTCTACCATAAGAGGG - Intergenic
998874252 5:146583497-146583519 GCTCAGATTTTAACCCAGGCAGG + Intronic
999868030 5:155722848-155722870 CTTCAGATTTTACATAAAGCTGG + Intergenic
1002292772 5:178211094-178211116 GTCCTGATTTTGCCACAACCTGG + Exonic
1004556215 6:16701010-16701032 GTTCAGATATTACCATACCCAGG - Intronic
1006934808 6:37709958-37709980 GGTTAGATTTTCCCAGAAGCAGG - Intergenic
1009551092 6:65091982-65092004 TTTCAGATTTCAACCCAAGCTGG - Intronic
1009632821 6:66221041-66221063 GTTCAGATTTTTCTACAAAATGG - Intergenic
1012447729 6:99323744-99323766 GTTCAGAATTTACTACACTCTGG + Intronic
1014303637 6:119713835-119713857 GGACAGCTTTTACCACAACCTGG + Intergenic
1016741039 6:147528765-147528787 GTTCAGTTTCTACCACATGCAGG + Intronic
1018012440 6:159683832-159683854 GTTCAGATTCTGCCAAAATCTGG + Intronic
1022675569 7:32495772-32495794 GGTCGGATTTCACCACAAGAAGG + Exonic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024391416 7:48817029-48817051 GTTCATATTTTATCACAACGTGG - Intergenic
1024421416 7:49171279-49171301 ATTGAGATTTTACTACAAGCTGG + Intergenic
1025092342 7:56074487-56074509 GTTCAGCTTTTACCACTAGATGG - Intronic
1027726980 7:81819045-81819067 GTTCTGATGTGAACACAAGCAGG - Intergenic
1027736490 7:81938922-81938944 GTTCTTATTTTACTACAAGTTGG + Intergenic
1031820376 7:126493501-126493523 GAACAGATTTTAACACAAGATGG + Intronic
1035179659 7:157080060-157080082 GTTTATTTTTTACCAAAAGCAGG - Intergenic
1035917248 8:3638099-3638121 GCTCAGATTTAAACCCAAGCAGG + Intronic
1037044525 8:14281578-14281600 GTTTAGATTTTATCACTAGATGG - Intronic
1039677040 8:39679743-39679765 GTTCATATTTTACCGCACTCTGG - Intronic
1044884715 8:96764997-96765019 GTACAGATTTTAACAAAGGCAGG - Intronic
1048215420 8:132489722-132489744 GTGCAGAATCTACCACAAGAGGG + Intergenic
1050527451 9:6558351-6558373 ATTCAGTTTTTTACACAAGCTGG + Intronic
1055036279 9:71821887-71821909 GTTCAGCCTTTGCCACAAGCAGG + Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1191995465 X:67090657-67090679 GCTCAGACTTAACCATAAGCAGG - Intergenic
1195560271 X:106275210-106275232 GATCAGATGTTATTACAAGCAGG + Intergenic
1195561691 X:106291129-106291151 GATCAGATGTTATTACAAGCAGG - Intergenic
1197797411 X:130312469-130312491 TTTCAAATTTTATCACAGGCTGG - Intergenic
1198799037 X:140431114-140431136 GCCCAGCTATTACCACAAGCTGG - Intergenic