ID: 955791466

View in Genome Browser
Species Human (GRCh38)
Location 3:62592696-62592718
Sequence CCTTCACAGCTGGCAGTGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955791461_955791466 16 Left 955791461 3:62592657-62592679 CCAACGCCAGGACGCCTGTGCTC 0: 1
1: 0
2: 0
3: 7
4: 122
Right 955791466 3:62592696-62592718 CCTTCACAGCTGGCAGTGCATGG 0: 1
1: 0
2: 1
3: 23
4: 246
955791459_955791466 25 Left 955791459 3:62592648-62592670 CCTTGTCCTCCAACGCCAGGACG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 955791466 3:62592696-62592718 CCTTCACAGCTGGCAGTGCATGG 0: 1
1: 0
2: 1
3: 23
4: 246
955791463_955791466 2 Left 955791463 3:62592671-62592693 CCTGTGCTCTCTGTGAACAGCTT 0: 1
1: 0
2: 0
3: 18
4: 215
Right 955791466 3:62592696-62592718 CCTTCACAGCTGGCAGTGCATGG 0: 1
1: 0
2: 1
3: 23
4: 246
955791460_955791466 19 Left 955791460 3:62592654-62592676 CCTCCAACGCCAGGACGCCTGTG 0: 1
1: 0
2: 0
3: 4
4: 132
Right 955791466 3:62592696-62592718 CCTTCACAGCTGGCAGTGCATGG 0: 1
1: 0
2: 1
3: 23
4: 246
955791462_955791466 10 Left 955791462 3:62592663-62592685 CCAGGACGCCTGTGCTCTCTGTG 0: 1
1: 0
2: 3
3: 14
4: 339
Right 955791466 3:62592696-62592718 CCTTCACAGCTGGCAGTGCATGG 0: 1
1: 0
2: 1
3: 23
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955791466 Original CRISPR CCTTCACAGCTGGCAGTGCA TGG Exonic
900253202 1:1682551-1682573 CCCGCACAGCTGACAGCGCATGG - Intronic
900350926 1:2234213-2234235 CCACCCCAGCTGGCTGTGCACGG + Intronic
900389894 1:2429247-2429269 TCTTCCCACCTGGCAGAGCATGG + Intronic
901929131 1:12585750-12585772 CCTGCACAGCTGACAGGACAAGG + Intronic
902999569 1:20255348-20255370 TCTCCACACCTTGCAGTGCACGG - Intergenic
903557794 1:24206179-24206201 CCCTCTCAGCTGACAGGGCAGGG - Intergenic
904338090 1:29810830-29810852 TCTTCACAGTTGGTAGTGAAAGG + Intergenic
905268941 1:36774005-36774027 CCGCCACAGCTGGCACTGAATGG + Intergenic
906133100 1:43473613-43473635 CCTTCTCAGCTGACAGAGTAAGG - Intergenic
907667047 1:56442458-56442480 CCTTCACAGCAGTCACTGTATGG + Intergenic
907703108 1:56808682-56808704 TCTTTAAAGCTAGCAGTGCATGG - Intronic
912346374 1:108966894-108966916 CCATCTCATTTGGCAGTGCAAGG - Intergenic
912834776 1:112986444-112986466 CCTGCAGAGCTGGCAGCACAAGG + Intergenic
916648916 1:166816900-166816922 CCTTCCTAGTTGGCAGGGCAGGG - Intergenic
917174271 1:172214846-172214868 CTTTTACAGCTGCCAGTGGAGGG + Intronic
917643820 1:177009707-177009729 CCTCCAGAGCAGGCAGTGTAAGG + Intronic
920124808 1:203685346-203685368 CCTATACATCTGGCAGTTCATGG + Intronic
920379202 1:205526158-205526180 CCCTCTCGGATGGCAGTGCAGGG - Exonic
922776939 1:228219153-228219175 GCATCACAGCTGCCTGTGCATGG + Intronic
1063171835 10:3516285-3516307 CCTTGAGAGCTGACTGTGCAGGG + Intergenic
1063460375 10:6211808-6211830 CCTTCTCAGCAGGCAGAGTAAGG - Intronic
1063571242 10:7216133-7216155 CGTTCACACCTGGCACTGCCTGG + Intronic
1063911982 10:10839224-10839246 CCCTCTCAGCTGACAGAGCAAGG + Intergenic
1065628257 10:27653253-27653275 CCTTCACAGCCTGCATGGCAGGG - Intergenic
1068113802 10:52713743-52713765 CCATCCCACCTGGCAGTGAAAGG - Intergenic
1069065522 10:63938195-63938217 CCTTCCCAGCTGGGAATGGAGGG + Intergenic
1069613877 10:69793722-69793744 CCCTCAGAGCTGTCAGTCCATGG - Intergenic
1069668304 10:70180060-70180082 CCTTCTCAGCTGACATAGCAAGG - Intergenic
1070740300 10:78898884-78898906 CCTCCACACCTGGCAGTGCCTGG - Intergenic
1071468368 10:85961279-85961301 CCTTCACAGCTGGCACCACCAGG + Intronic
1073445713 10:103579109-103579131 CCTGCACTGCTGGCAGCGTATGG + Intronic
1076197763 10:128532429-128532451 CCTGCACAAATGCCAGTGCATGG + Intergenic
1076311630 10:129511876-129511898 CCTCCACAGCGGCCAGTGCTGGG - Intronic
1076910181 10:133383994-133384016 CCTTCTCAGCCGGCAGGGGAGGG - Exonic
1077085682 11:749003-749025 CCATTACACTTGGCAGTGCAGGG + Intronic
1077537927 11:3133416-3133438 GCTTCCCCGCAGGCAGTGCAGGG - Intronic
1079105092 11:17566048-17566070 CCTTCTCAGCTGACAGAGAAAGG + Intronic
1080665721 11:34334194-34334216 CCTTTACATCTGGCACAGCAAGG + Intronic
1081533529 11:43981591-43981613 TCCTCGCAGCTGGCAGTCCATGG + Intergenic
1081639743 11:44744651-44744673 TCTTCACAGCTAGCTTTGCAGGG + Intronic
1081731975 11:45378053-45378075 CCTTCACGCCTGGCAGTTCCTGG + Intergenic
1081983974 11:47288380-47288402 ACATCAGAGCTGGCAGTGAAAGG + Intronic
1082696071 11:56366235-56366257 CCTTCTCAGCTGACAGATCAAGG - Intergenic
1084797828 11:71519782-71519804 ATGGCACAGCTGGCAGTGCAGGG + Intronic
1085521107 11:77139346-77139368 CCTGCATAGCTGGCAGGGCCTGG + Intronic
1085912838 11:80849034-80849056 CCTTCACTTCTGTCAGTTCATGG - Intergenic
1087340464 11:96899095-96899117 CCCTCTTAGCTGGCAGAGCAAGG + Intergenic
1089202357 11:116732031-116732053 GCCTCAGAGCTGGCAGTGCTAGG + Intergenic
1089700581 11:120241644-120241666 CCTTCTCTGCGGGCAGTGAAGGG - Intronic
1093340584 12:17968169-17968191 CCTTCTAAGCTGACAGAGCAAGG + Intergenic
1093978467 12:25449996-25450018 ACTTCTCAGCTGACAGAGCAGGG + Intronic
1094837347 12:34328318-34328340 CCTTCCCAGCAGCCACTGCATGG - Intergenic
1096490221 12:52008969-52008991 CCTTCATACCTGGGACTGCAGGG - Intronic
1097154639 12:57003871-57003893 CTTGCACACCTGGCAGGGCATGG + Exonic
1098652804 12:72994209-72994231 CCCTCTCAGCTGACAGAGCAAGG + Intergenic
1099038430 12:77619554-77619576 CCTTCTAAGCAGGCATTGCATGG + Intergenic
1099669190 12:85668962-85668984 CTTTCACAGCTGGCTGGGCACGG + Intergenic
1102109576 12:110354761-110354783 CCTTCTGAGCTGACAGTACAAGG - Intergenic
1103305573 12:119961305-119961327 CCCTCACAGCTTGCAGTGTGGGG - Intergenic
1103415999 12:120741760-120741782 CCTTCTCAGCGGGTAGGGCAGGG - Intergenic
1105923252 13:24984337-24984359 CCTCCAGAGCTGGCACTTCATGG + Intergenic
1106999468 13:35526774-35526796 CCAGCACACCTGGCTGTGCACGG - Intronic
1107679938 13:42837845-42837867 CAGTGACAGCTGGCACTGCATGG + Intergenic
1109443137 13:62400363-62400385 CCTTCAGAGCTGACAGAGGAGGG - Intergenic
1112563993 13:100536862-100536884 CCCTCACACCTGGCAGAGGATGG - Intronic
1112943455 13:104894837-104894859 GCTTCTCAGCTGACAGGGCAAGG + Intergenic
1113188333 13:107715650-107715672 CCTTGACAGGTTGCAATGCAAGG + Intronic
1114672353 14:24418022-24418044 CCTGCACAGCTCTCAGGGCAGGG + Exonic
1116063101 14:39948666-39948688 CATTCACATCTCTCAGTGCAAGG - Intergenic
1117106600 14:52403683-52403705 TCTTCAAAGCTGGCAATGGAGGG - Intergenic
1117478631 14:56120408-56120430 TGTTCATAGCTGGAAGTGCAGGG + Intronic
1117673444 14:58131599-58131621 CCTCCAAAGCAGGAAGTGCAGGG + Exonic
1118301264 14:64618611-64618633 CTTTCACAGCCAGCAGGGCAGGG + Intergenic
1118389670 14:65285520-65285542 CATTCACAGATGGTAGGGCAGGG + Intergenic
1119760353 14:77146469-77146491 CCTGGACACCTGGCATTGCAGGG - Intronic
1119933035 14:78566508-78566530 CCTTCCAAGCTGGCGGTGCTGGG + Intronic
1122164230 14:99809542-99809564 CCCAGAAAGCTGGCAGTGCACGG - Intronic
1124199881 15:27670074-27670096 CCTTCTCAGCTGACAGAACAAGG - Intergenic
1124790184 15:32719141-32719163 CCTCCACAGCTTGCGGAGCAAGG + Intronic
1125020121 15:34976201-34976223 CCTTCACAGGGGGTAGGGCATGG - Intergenic
1126423564 15:48501379-48501401 ACTTCACAGCTGAAAGTGGAAGG - Intronic
1127906676 15:63381376-63381398 TCTTCAGAGCTGGCGGTGCCCGG + Intronic
1128106845 15:65051537-65051559 CCACCACAGCTGCCAGGGCAAGG - Exonic
1130101161 15:80895169-80895191 CCTGCATAGCTGCCAGTTCAAGG - Intronic
1132205035 15:99980596-99980618 ACTCCCCAGCTGGCAGGGCACGG - Intronic
1132376487 15:101331594-101331616 CCTTCCCAGCTGGGAGAGCAGGG - Intronic
1133233701 16:4378119-4378141 CCTGCACACCTGGCCTTGCAGGG + Intronic
1133605753 16:7386077-7386099 CCTTAAAAGCTGGCTGGGCATGG - Intronic
1135711133 16:24718194-24718216 CCTTCTCTGCTGGCAGTGCCTGG + Intergenic
1137497581 16:48982675-48982697 GGTTCACACCTGGCAGAGCAGGG - Intergenic
1138680734 16:58682030-58682052 CCTGCACAGCTGGGATTACAGGG - Intronic
1139221919 16:65191887-65191909 CCCTCTCAGCTGGCAGAGCCAGG + Intergenic
1141180921 16:81752881-81752903 AGTTGACAGGTGGCAGTGCAAGG - Intronic
1141752071 16:85965186-85965208 CCCTCACGGCTGGCGATGCAGGG - Intergenic
1142803221 17:2357998-2358020 CCTTCACAGGTGGGAGCCCAGGG + Intronic
1143195403 17:5072485-5072507 TCTTCACAGCTGGAGGTGTAAGG + Intergenic
1143597649 17:7924865-7924887 CCTGAACAGCTGGGAGTACAAGG + Intronic
1144034932 17:11356558-11356580 CCTCCACAGCTGTCAGTCAAGGG - Intronic
1144164657 17:12598016-12598038 CCATCACAGCTGGATTTGCAAGG - Intergenic
1144521161 17:15953100-15953122 CCTGCAGAGCTGGGAGTGCAGGG + Intronic
1147849497 17:43430868-43430890 CCTTCACATCTGGTATTTCATGG - Intergenic
1148342002 17:46878776-46878798 ACTTCATGGCTGGCAGTGCCAGG + Intronic
1148692614 17:49540009-49540031 CCTTCTCATCTGACAGAGCAAGG + Intergenic
1149619143 17:58029059-58029081 CCCTCTCAGCTGACAGAGCAAGG - Intergenic
1149967391 17:61179322-61179344 CCCTCACAGATGTCAGTGCATGG + Intronic
1150594223 17:66590108-66590130 CCTGCCCAGCTGCCAGTGTATGG - Intronic
1151530021 17:74698225-74698247 CCTCAGCAGCTGGCAGTGCCAGG - Intronic
1152153315 17:78616446-78616468 CCTTAGCCACTGGCAGTGCAGGG - Intergenic
1152322474 17:79615656-79615678 CTTACACAGGTGGCAGTGCGTGG - Intergenic
1152564303 17:81093280-81093302 CCTCCAGAGCTGGCTGAGCAGGG - Intronic
1152908989 17:82986357-82986379 CCAACACACCTGGCATTGCACGG - Intronic
1155208432 18:23580560-23580582 CCACCAGAGCTGGGAGTGCAGGG + Intronic
1155700110 18:28733092-28733114 AGATCACAGCTGGCAGAGCATGG - Intergenic
1155851110 18:30775036-30775058 CCTTGACACCTGGCATTGCAGGG + Intergenic
1157587693 18:48815604-48815626 CATCCAAAGCTGGCACTGCAGGG + Intronic
1158642133 18:59212959-59212981 CCTTCCCAGGGGGCCGTGCACGG + Intergenic
1159002077 18:62983255-62983277 CCCTCACCACTGGCACTGCAGGG + Intergenic
1160021836 18:75187266-75187288 CTTGCAGACCTGGCAGTGCATGG + Intergenic
1160292735 18:77609175-77609197 CCTTCTGAGTTGGCAGGGCAGGG + Intergenic
1160367289 18:78337231-78337253 CCCTCTCAGCTGACAGAGCAAGG + Intergenic
1161655298 19:5510668-5510690 CCTTCACAGCCAGCAGTGGCTGG + Intergenic
1161740376 19:6017702-6017724 CCTTCAGAGTGGGCAGTGCTGGG + Intronic
1162010626 19:7811795-7811817 CCTTGATAGCTGGAAGTGCTGGG + Intergenic
1166742593 19:45123292-45123314 CCTTCACAGGTGCCAGTGCTGGG - Intronic
1167602111 19:50460246-50460268 CGTTCACAGCTGGAAGGGCAGGG + Intronic
1168153205 19:54460063-54460085 CAGTCTCAGCTGGCAGGGCAGGG - Intronic
1168320759 19:55508228-55508250 GCTTCCCAGCTGGCAGTGGCGGG - Intronic
925182068 2:1823790-1823812 CCGCCACCACTGGCAGTGCAGGG - Intronic
925417573 2:3681775-3681797 TCTGCACACCTGGCTGTGCAAGG + Intronic
928904211 2:36354374-36354396 AGTTAATAGCTGGCAGTGCAAGG - Intergenic
932347764 2:71006907-71006929 CCCCTGCAGCTGGCAGTGCAGGG + Intergenic
932402371 2:71489767-71489789 CCATCAGAGCTTGCAGGGCAGGG + Intronic
933648910 2:84833205-84833227 CCTAGACAGCTGCCAGTGCAGGG + Intronic
933655680 2:84885087-84885109 CCTGCACACCTGGCAGTGGAGGG - Intronic
934944205 2:98525238-98525260 TCTTCAAAGCTGGCAGTGGCAGG + Intronic
935599609 2:104909586-104909608 CCTTCACAGCTGCCTCTGCCAGG + Intergenic
935690056 2:105723018-105723040 CCATCAAAGCTGGCACTGCGGGG + Intergenic
938318254 2:130344835-130344857 ACTGCACAGATGGCATTGCAGGG + Intronic
940570543 2:155427478-155427500 ACTTCAAGGCTGGCAGTGTAAGG - Intergenic
942599522 2:177626709-177626731 CCTTTACAGCTGTCTCTGCAGGG - Exonic
944023224 2:195131304-195131326 CTATCACAGCTGGAGGTGCATGG - Intergenic
944845252 2:203661703-203661725 CCCCCACAGTTGGGAGTGCAGGG - Intergenic
944946324 2:204690518-204690540 TCTTCACAGCTGGCATTGGCTGG - Intronic
945510632 2:210698042-210698064 CCTTCTCAGCTGACAGAGCAAGG + Intergenic
947116354 2:226775584-226775606 CCTTCTCAGCTGACAGAGCATGG - Intronic
948913392 2:241017771-241017793 TCTTCACAGCTGGCTGTGCCTGG - Intronic
1169334359 20:4743252-4743274 CCTTCTCAGATGACAGAGCAAGG - Intergenic
1170853773 20:20029082-20029104 TCATCATAGCTGGCCGTGCATGG - Intronic
1174216796 20:48921969-48921991 CCTGCGCAGCTGGGAGTGCTGGG - Exonic
1175116491 20:56686106-56686128 CCCTCTCAGCTGGCAGAGGATGG + Intergenic
1175678371 20:60966441-60966463 CCTTGACTGATGGCTGTGCAAGG + Intergenic
1178775951 21:35550852-35550874 CCTTTGCAGCTGCCTGTGCATGG + Intronic
1180594830 22:16966268-16966290 GCTTCACAGCCGGCAGGGTAGGG + Exonic
1182749002 22:32626970-32626992 CCTCCAAAGCTGGGGGTGCAGGG - Intronic
1183091759 22:35527045-35527067 CTTTCACAGCGGTCTGTGCAAGG - Intergenic
1184825516 22:46947974-46947996 CATTCACAGCTGGCATTAAAAGG - Intronic
1184894838 22:47400848-47400870 CCTCCACAGCCTGGAGTGCATGG + Intergenic
950243565 3:11393969-11393991 CCTACAAAGCTGGCCGGGCATGG - Intronic
950354519 3:12395045-12395067 CCTTCAAAGCTGTGAGTGCATGG - Intronic
950572931 3:13813207-13813229 GCTTCACAGCTGGCATCCCATGG + Intergenic
955791466 3:62592696-62592718 CCTTCACAGCTGGCAGTGCATGG + Exonic
955913088 3:63878454-63878476 CCTTCACACCAAGCACTGCATGG - Intronic
955960392 3:64334735-64334757 CCTTCAATACTGGCAGTACAGGG + Intronic
956411114 3:68980789-68980811 TTTCCACAACTGGCAGTGCAGGG - Intronic
958139788 3:89547580-89547602 ACTTCACAGCTGGAAATGGAAGG + Intergenic
962428098 3:135292384-135292406 CCTTCTCAACTGACAGAGCAGGG - Intergenic
966904112 3:184509261-184509283 CCTCCACAGCTGTCCCTGCATGG + Intronic
968951498 4:3696861-3696883 CCCTCTCAGCTGGCAAAGCAAGG + Intergenic
968976008 4:3822346-3822368 CCCTCCCACCTGGCAGTGCCCGG + Intergenic
969248942 4:5954581-5954603 CCTCCACGGCAGGCAGCGCATGG + Intronic
969502324 4:7560606-7560628 CCTTCAAAGATGTCAGTGCAGGG - Intronic
969674970 4:8609630-8609652 GCCTCAGAGCTGGCAGGGCAGGG + Intronic
969978873 4:11133529-11133551 TCTCCATAGCAGGCAGTGCAGGG - Intergenic
970168473 4:13264667-13264689 CAGTCACAGCTGGAAGTTCATGG + Intergenic
970257289 4:14181828-14181850 TCTTCACAGCAGGCTGGGCATGG + Intergenic
970508267 4:16754967-16754989 CCATCTCAGCAGGCAATGCAGGG - Intronic
970968385 4:21953138-21953160 TCTTCACAGCTGGCTGTCCTTGG - Intergenic
972405306 4:38740545-38740567 CCTTGACAGCTGGCATTGGATGG - Intergenic
972599072 4:40555826-40555848 CCTTCACAGGTGACAGCACAAGG - Intronic
973225026 4:47774339-47774361 CTTTCACACCCGGGAGTGCAGGG - Intronic
974715707 4:65668208-65668230 CCTTTAGAGCTGGCATTGCTGGG + Intronic
974757754 4:66233513-66233535 CCCTCTCAGTTGGCAGAGCAAGG + Intergenic
978148714 4:105409218-105409240 TCTTCACAACTGGCAGACCATGG + Intronic
979423759 4:120538820-120538842 CCTTCTGAGCTGACAGCGCAAGG + Intergenic
980608962 4:135131662-135131684 CCCTCACAGCTGACAGAGCAAGG + Intergenic
981247539 4:142557502-142557524 CCTGTCCAGCTGGCAGTCCATGG + Intronic
981801316 4:148660368-148660390 CCATCTCAGCTGACAGAGCAAGG + Intergenic
982411320 4:155080825-155080847 CCTTCTCATCTTTCAGTGCATGG - Intergenic
984836530 4:184027516-184027538 TCTTCTCAGCTGACAGAGCAAGG + Intergenic
986131808 5:4939102-4939124 CCTCCACAGCTGGCGTTGCCCGG + Intergenic
986250107 5:6047709-6047731 ACCTGACAGCTGGCAGTGCCCGG + Intergenic
986621436 5:9679840-9679862 CCTGCACAGCTGACACAGCAAGG - Intronic
987969804 5:24928095-24928117 ACTTCACAGTTGGTTGTGCATGG - Intergenic
992257142 5:74932550-74932572 CCTGCACAGCTGAAAGTGGAGGG - Intergenic
994498699 5:100546229-100546251 CCTTCACAGTTGTCAGAGCTTGG + Intronic
997477122 5:134149980-134150002 GGTTCTCAGCTGGCAGTGAAGGG - Exonic
997590133 5:135067254-135067276 CTTTCACAGCTGGCTTTCCAAGG - Intronic
998437009 5:142119033-142119055 CCTTCTAAGCTGACAGAGCAAGG + Intronic
999564465 5:152841896-152841918 ACTTCACAGTGGGCAGTGCTAGG - Intergenic
1000514512 5:162223862-162223884 CCCTCTCAGCTGACAGAGCAAGG - Intergenic
1002554333 5:180023277-180023299 CCTTCTCAGCTGACAGAACAAGG - Intronic
1002591945 5:180296542-180296564 CCATCTCAGCTGACAGAGCAAGG - Intergenic
1003027407 6:2567684-2567706 CCTTCTCAGCTAACAGAGCAAGG + Intergenic
1003375893 6:5577381-5577403 CCCTCAAAGCTGGCAGAGCTAGG - Intronic
1005002089 6:21251878-21251900 CCCTCTCAGCTGACAGAGCAAGG + Intergenic
1006740189 6:36302423-36302445 CCTCCACAGGTGGCTGAGCAGGG - Exonic
1009266069 6:61556160-61556182 CCTGCAGTGGTGGCAGTGCAGGG + Intergenic
1010307842 6:74345613-74345635 CCTTCACAGTTGCCACAGCAAGG + Intergenic
1011465016 6:87646274-87646296 ACTTCACAATTGGCAGAGCACGG - Intronic
1011907965 6:92396147-92396169 CCCTCTCAGCTGACAGAGCAAGG + Intergenic
1012220947 6:96648695-96648717 CGTGCACAGCTGTCAGGGCACGG + Intergenic
1013427183 6:110023420-110023442 CCTTCACCACTGGCAGTGCAGGG - Intergenic
1016599216 6:145837915-145837937 CCTTCATAGCTGGCAGGCAATGG - Intergenic
1018857621 6:167685829-167685851 CCTTCCCAGCTCCCTGTGCAGGG - Intergenic
1019173914 6:170150168-170150190 TCTACACTGCGGGCAGTGCAGGG - Intergenic
1019295649 7:272631-272653 CCTCCTCAGCTCGCAGTCCAAGG + Intergenic
1020659522 7:10965917-10965939 TCTTCACAGCAGGCAGACCAGGG - Intergenic
1021254227 7:18370277-18370299 CCTTCCAAGCTAGCAGTGAAAGG + Intronic
1022415990 7:30177421-30177443 CTTTCCCAGCTGTCACTGCAGGG - Intergenic
1022505061 7:30904654-30904676 CCTCCACCTCTGACAGTGCATGG - Intergenic
1022841184 7:34165432-34165454 TCTTCACATTTTGCAGTGCAGGG + Intergenic
1023140818 7:37100656-37100678 CCTCCACAGGTGACAGGGCATGG - Intronic
1024534619 7:50419905-50419927 CCTTCAGAGCTGACTCTGCAAGG + Intergenic
1028450173 7:90973321-90973343 GCTGCACATATGGCAGTGCACGG + Intronic
1029187090 7:98747004-98747026 CCATCCCAGCTGGCAGCGGATGG - Intergenic
1029274148 7:99394213-99394235 CCTGCAGAGATGGCACTGCATGG + Intronic
1029496571 7:100898120-100898142 CCTCCACAGCTGTCACTGCAGGG + Intergenic
1031858584 7:126951917-126951939 CCTTCTCAGCAGGCAGAGCCAGG - Intronic
1033681142 7:143598121-143598143 CCATCCCAGCTGCTAGTGCATGG + Intergenic
1033685361 7:143635411-143635433 ACTTCAGAGCTGGAAGTGCAGGG - Intronic
1033688531 7:143714629-143714651 ACTTCAGAGCTGGAAGTGCAGGG - Intronic
1033699254 7:143822209-143822231 ACTTCAGAGCTGGAAGTGCAGGG + Intergenic
1033703750 7:143863692-143863714 CCATCCCAGCTGCTAGTGCATGG - Exonic
1034188751 7:149197804-149197826 CTGCCCCAGCTGGCAGTGCAGGG + Intronic
1034386993 7:150748266-150748288 ACTTCCCACCTGGCAGTGAAAGG - Intronic
1034413633 7:150953990-150954012 CCTTCACAGATGGCGCTGCTGGG + Intronic
1035605661 8:928547-928569 CCTTCACAGATGCCTTTGCAAGG - Intergenic
1037228773 8:16628682-16628704 GCTTCACATGTGGCAGTGCGGGG - Intergenic
1038485092 8:27929378-27929400 CCTACCCAGCTGGCACTGTAGGG - Intronic
1040436857 8:47399359-47399381 CCTTCCCAGCTGTCCGTGGATGG - Intronic
1041440764 8:57894037-57894059 GCTTCTCAGCTGACAGGGCAAGG + Intergenic
1042411313 8:68469433-68469455 CCTTCACACCTAGCAGAGGAAGG - Intronic
1042782205 8:72504328-72504350 CCTTCTCAGCTGATAGAGCAAGG - Intergenic
1047746728 8:127850549-127850571 TCTGCAAAGCTGGCTGTGCATGG - Intergenic
1049253864 8:141603677-141603699 CCTTCACAGCTGGGTGTCCTTGG + Intergenic
1049725462 8:144143658-144143680 CCTTCATGGAGGGCAGTGCATGG + Intergenic
1049870974 8:144975786-144975808 CCATCACACTTGGAAGTGCAAGG + Intergenic
1051767132 9:20537034-20537056 GTTTTACAGCTGGCAATGCAGGG - Intronic
1057746350 9:97754883-97754905 CCTTCTCAGCAGACAGAGCAAGG + Intergenic
1057826881 9:98378351-98378373 CCATCACAGCTGGCAGGGTGGGG - Intronic
1057931768 9:99199816-99199838 CCCTCTCAGCTGACAGAGCAAGG + Intergenic
1058977513 9:110138208-110138230 GCTGCACAGCTGGCAGTGGCTGG - Exonic
1059233780 9:112745115-112745137 CCTTCAGTGATGGCAGTGAAAGG + Intergenic
1060036356 9:120259430-120259452 CCATCCCAGCTTGCAGTACATGG + Intergenic
1060834457 9:126744651-126744673 GCTTCTCAGGTGACAGTGCAAGG - Intergenic
1061216070 9:129222695-129222717 CCTTTACGGGAGGCAGTGCACGG + Intergenic
1061395715 9:130342421-130342443 GCTTCACCTCTGGCAGGGCACGG - Intronic
1187155538 X:16717658-16717680 CCTTCAGAGCAGGGAGTTCATGG - Intergenic
1190063459 X:47225081-47225103 CCTTCCCGGATGGCGGTGCAGGG - Exonic
1194581628 X:95679335-95679357 CCTACACAGCTGTCAGAGTATGG + Intergenic
1197879348 X:131148887-131148909 CCGTCTCAGCTGACAGAGCAAGG + Intergenic
1199606501 X:149583546-149583568 CCTTCACTGCTGACACTGCCTGG + Exonic
1199632621 X:149785822-149785844 CCTTCACTGCTGACACTGCCTGG - Exonic
1199947965 X:152682631-152682653 CCTTGACTGCTGGCACTGCCTGG - Intergenic
1199961714 X:152785823-152785845 CCTTGACTGCTGGCACTGCCTGG + Intergenic
1200011396 X:153123406-153123428 CCTTCAGAGCGGGGGGTGCAGGG + Intergenic
1200028204 X:153276516-153276538 CCTTCAGAGCGGGGGGTGCAGGG - Intergenic
1200084000 X:153593951-153593973 CCTTCTGAGCTGCCCGTGCATGG + Intronic
1200153968 X:153965496-153965518 CCCTCACACCTGGCAGGCCAGGG + Intronic
1200392915 X:155962550-155962572 CCCTCACAGCTGACAATGCAAGG + Intergenic
1202048015 Y:20753485-20753507 CCTGCACAGCTGACTCTGCATGG - Intergenic