ID: 955791892

View in Genome Browser
Species Human (GRCh38)
Location 3:62596663-62596685
Sequence CTAGTGTTCTCTAGTACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 1, 2: 14, 3: 64, 4: 394}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955791892_955791896 20 Left 955791892 3:62596663-62596685 CCTGTAGTACTAGAGAACACTAG 0: 1
1: 1
2: 14
3: 64
4: 394
Right 955791896 3:62596706-62596728 CTGTACTTTTGTATCCTTTGTGG 0: 1
1: 0
2: 0
3: 28
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955791892 Original CRISPR CTAGTGTTCTCTAGTACTAC AGG (reversed) Intronic