ID: 955792361

View in Genome Browser
Species Human (GRCh38)
Location 3:62601832-62601854
Sequence GAAAGTGAACACTTTGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955792356_955792361 1 Left 955792356 3:62601808-62601830 CCTGTTCCACAGTACCACCACTT 0: 1
1: 0
2: 0
3: 8
4: 110
Right 955792361 3:62601832-62601854 GAAAGTGAACACTTTGATCTGGG 0: 1
1: 0
2: 1
3: 20
4: 193
955792357_955792361 -5 Left 955792357 3:62601814-62601836 CCACAGTACCACCACTTTGAAAG 0: 1
1: 0
2: 1
3: 16
4: 239
Right 955792361 3:62601832-62601854 GAAAGTGAACACTTTGATCTGGG 0: 1
1: 0
2: 1
3: 20
4: 193
955792355_955792361 6 Left 955792355 3:62601803-62601825 CCAAACCTGTTCCACAGTACCAC 0: 1
1: 0
2: 1
3: 16
4: 95
Right 955792361 3:62601832-62601854 GAAAGTGAACACTTTGATCTGGG 0: 1
1: 0
2: 1
3: 20
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955792361 Original CRISPR GAAAGTGAACACTTTGATCT GGG Intronic
905400040 1:37694705-37694727 GAAATTGGACACTTTGCTCAAGG + Intronic
905753101 1:40483520-40483542 GAAAGTGTACAGTTTGGGCTGGG - Intronic
907090130 1:51715912-51715934 GAAAGAGATCATTTTGAACTTGG - Intronic
907627468 1:56044104-56044126 GAAGGAGAACACTTTGAAATGGG - Intergenic
907800965 1:57765398-57765420 GAAAGTGAAGCCTTTGAACTTGG - Intronic
907954904 1:59218778-59218800 GAAGGTCAACACCTTGATTTTGG - Intergenic
909975652 1:82043327-82043349 GAGAGCAGACACTTTGATCTTGG - Intergenic
910711634 1:90188148-90188170 GGACGTGAACACTTTGAGGTCGG - Intergenic
911301824 1:96183946-96183968 GAAAGTGAAAATTTTTATTTGGG + Intergenic
913168373 1:116210262-116210284 GAAAGAGAACACTGTACTCTTGG - Intergenic
913657513 1:120975286-120975308 TAAAGACAAGACTTTGATCTTGG + Intergenic
914008864 1:143758369-143758391 TAAAGACAAGACTTTGATCTTGG + Intergenic
914522080 1:148426559-148426581 TAAAGACAAGACTTTGATCTTGG + Intergenic
914647494 1:149667021-149667043 TAAAGACAAGACTTTGATCTTGG + Intergenic
916337004 1:163684198-163684220 TAAAGTGAACATTTTGTTTTGGG + Intergenic
917078530 1:171232743-171232765 GCAAGTGAACAATTTTATCTAGG + Intergenic
917083471 1:171281266-171281288 GTAAGTGAACTCTGTGACCTTGG + Intronic
917658010 1:177146746-177146768 GAAAGTGAACTAAGTGATCTCGG - Intronic
918648210 1:186926537-186926559 GAAAGTGAAGACTTTGATAGGGG - Intronic
921623883 1:217356878-217356900 GAAAGTACAGACTGTGATCTGGG + Intergenic
921813164 1:219537333-219537355 GAAACTGACCTCTTTGCTCTGGG + Intergenic
922310991 1:224390674-224390696 TAAAGTGTACACTTTGAACCCGG + Intronic
922415598 1:225419688-225419710 GAAAGTGTTCCCTTTCATCTTGG - Intronic
1064200551 10:13281116-13281138 CAAAGTGAACAAATTGATATTGG + Intronic
1065455324 10:25901290-25901312 GAAAGTGTCCCCTTTGCTCTTGG - Intergenic
1068458271 10:57289340-57289362 GAAAGTGAAATCTGTGTTCTTGG - Intergenic
1070860830 10:79659657-79659679 ATATGTGAGCACTTTGATCTGGG - Intergenic
1070876434 10:79815923-79815945 ATATGTGAGCACTTTGATCTGGG + Intergenic
1071426699 10:85562899-85562921 GAAAGAGAACACTTAGCTTTTGG + Intergenic
1071643364 10:87338099-87338121 ATATGTGAGCACTTTGATCTGGG + Intergenic
1071947821 10:90667485-90667507 GAAAGTAAACAATTAGATATTGG - Intergenic
1072524035 10:96255728-96255750 GAAAGTGTAGGCTTAGATCTTGG - Intronic
1074154934 10:110789776-110789798 GAAAGTGAACACCTATCTCTGGG - Intronic
1074911661 10:117915579-117915601 GAAAGGGTACACTGTGTTCTAGG + Intergenic
1075827579 10:125372817-125372839 GACAGTGAACACATTAACCTGGG + Intergenic
1077538246 11:3134632-3134654 AAAAGGGAACACTTTGGACTTGG + Intronic
1080050677 11:27855902-27855924 GGAAGAGAAAAATTTGATCTGGG + Intergenic
1087061165 11:93979160-93979182 GCAAATGAACACTTTGATGAAGG + Intergenic
1087245716 11:95833995-95834017 CAAACTGAACATTTTCATCTGGG + Exonic
1088317457 11:108521645-108521667 AAAAGGGAACACTTTGATGTAGG - Intronic
1090286760 11:125506346-125506368 GGAAGTGCACAGATTGATCTAGG - Intergenic
1093236305 12:16611591-16611613 GAAACTGAACACTTTGAACCTGG + Intergenic
1093815466 12:23540542-23540564 GAAAGTGAAGAGTTTGCGCTGGG + Intronic
1095040131 12:37432323-37432345 GCAGGAGAACACTTTGATCCTGG - Intergenic
1095457088 12:42399647-42399669 CAAAGTGAAAACTTTTCTCTAGG + Intronic
1099103116 12:78467637-78467659 GCAAGTGAACACTGTTCTCTTGG - Intergenic
1099138236 12:78935961-78935983 GAAAATGAACTCTTTGTACTTGG - Intronic
1099140363 12:78966391-78966413 GAAATTGAACAATTTTCTCTAGG + Intronic
1099787857 12:87289279-87289301 GCAAGCCAACACTTTAATCTTGG + Intergenic
1100085642 12:90906962-90906984 AAAAGGGAACACTTTTATATTGG + Intronic
1100191902 12:92201933-92201955 GAAAGTCAAAACTTTGCTCCTGG + Intergenic
1100824890 12:98465342-98465364 GAAAATCAACACCTTGATTTTGG - Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102753199 12:115314161-115314183 GTAAGTGCACGCTTTGCTCTGGG - Intergenic
1104825745 12:131708384-131708406 GCAAGTGAACAATTTTATCTAGG + Intergenic
1108434184 13:50385583-50385605 GCCAGTCAACACCTTGATCTTGG + Intronic
1110068392 13:71140223-71140245 GAATCAGAAAACTTTGATCTAGG + Intergenic
1110397877 13:75052975-75052997 AAAAGTGAACACTTGGAAGTTGG + Intergenic
1111617675 13:90681800-90681822 GAAAATAAAGACTGTGATCTAGG - Intergenic
1114833980 14:26181129-26181151 GAAAATAAACATTTTGATTTCGG - Intergenic
1116225329 14:42143677-42143699 GAAAATGAAAAATTTGACCTGGG - Intergenic
1118949722 14:70423803-70423825 GAAAGGGAACACTTGTAACTTGG + Intergenic
1119285617 14:73451934-73451956 GTAATTGAAGACTTTGATCTTGG + Intronic
1123921852 15:25075767-25075789 GCAAGGGATGACTTTGATCTTGG + Intergenic
1125187037 15:36942869-36942891 GAAAGTAAACAATATGATATTGG + Intronic
1126749595 15:51863409-51863431 GAAAGGGAACAATTAGATTTAGG - Intronic
1128833654 15:70791739-70791761 CAAAGTGAACACTTTAGCCTAGG + Intergenic
1130827739 15:87566656-87566678 GAAAGTGCCAACTATGATCTTGG + Intergenic
1133736018 16:8616364-8616386 TCAAGGGAACACTTTGATCCAGG + Intergenic
1134375928 16:13673173-13673195 CAAAGATAGCACTTTGATCTTGG + Intergenic
1137817050 16:51408312-51408334 GAAAGTTAAGAGTTTGATATTGG - Intergenic
1137882655 16:52068269-52068291 CTAAGTGAAAACATTGATCTAGG + Intronic
1139065306 16:63305790-63305812 GAAAGGGAACAATTTGAGCATGG + Intergenic
1139128701 16:64113993-64114015 GAAAGGAAACACTTGGATCTTGG + Intergenic
1140336417 16:74109157-74109179 GAAGGAGAACATTTTTATCTTGG - Intergenic
1140684844 16:77423819-77423841 GGAAATGAACACTTTGATACTGG - Intronic
1140745720 16:77978566-77978588 GAAAGTGACCACTTTGACCATGG + Exonic
1143198182 17:5092983-5093005 TACAGTGAACACTTTGATGTCGG - Exonic
1144796578 17:17895585-17895607 AAAGGTGAAGACATTGATCTAGG + Intronic
1148869988 17:50652549-50652571 GCAAGTGAACAGTTTTATCTAGG + Intronic
1149242837 17:54670651-54670673 AAAAGTGAACCCTTTTTTCTGGG - Intergenic
1149853473 17:60056616-60056638 AAAAGTAAACTCTTTTATCTAGG + Intronic
1150292416 17:63989244-63989266 GGAAGTCACCACTTTGTTCTGGG - Intergenic
1151128794 17:71874234-71874256 GAAACTGAAAATTTTTATCTAGG + Intergenic
1152849662 17:82625441-82625463 GAATGTGAACACCTTAATCATGG + Exonic
1153683263 18:7521451-7521473 GAAAGAGAACCCTGTGTTCTTGG - Intergenic
1155643926 18:28054325-28054347 ACAAGTGAACAATTTTATCTAGG - Intronic
1155868576 18:30997306-30997328 AAATGTGAACTCCTTGATCTTGG - Intronic
1156685372 18:39638817-39638839 GAATGTTAAGACTTTGGTCTGGG + Intergenic
1157511125 18:48275545-48275567 AAAAGTGAACCCTGTGATTTAGG - Intronic
1158952800 18:62510993-62511015 GAAATTTAACAGTGTGATCTGGG + Intergenic
1161613907 19:5259281-5259303 GAAAGTGAAGTCTTTGATTTGGG - Intronic
1162328293 19:10011452-10011474 GAAAGTGAAAACTGTGTTTTGGG - Intergenic
1164592694 19:29514842-29514864 GAAAGTGGAGACCTTGCTCTTGG - Intergenic
927005716 2:18846111-18846133 GAATCTCAACACTTTGTTCTAGG + Intergenic
927848103 2:26481909-26481931 CACAGTGAGCACTTTGATCCAGG + Intronic
928222072 2:29412150-29412172 GAGAGACACCACTTTGATCTTGG + Intronic
928801859 2:35103782-35103804 GACAGAGAACACTGTGAGCTAGG + Intergenic
930993925 2:57693322-57693344 GAAAATGGAGACTGTGATCTGGG - Intergenic
931245179 2:60486373-60486395 GAAAGTGAACTCTTAGAATTTGG - Intronic
939810314 2:146823830-146823852 GAAAGAGAACACCTTTATTTTGG + Intergenic
941256602 2:163240102-163240124 GAAAATGAACAATTAGATCAAGG - Intergenic
942373063 2:175306883-175306905 AAAAGTGCACTCATTGATCTAGG + Intergenic
945121880 2:206465472-206465494 TAAATTTAACACTTTTATCTTGG - Intronic
947197627 2:227584389-227584411 GAAAGTAAATAATTTGATTTTGG + Intergenic
947235314 2:227935371-227935393 GAATGGGAGCACCTTGATCTTGG + Intergenic
1170306994 20:14949159-14949181 TAAAGTGAACATTTTGGTCTTGG - Intronic
1170525584 20:17233008-17233030 GATAGAGAACACTGTGGTCTAGG - Intronic
1172603160 20:36197360-36197382 GAAAGTGGACACTGGGATCCAGG + Intronic
1173230943 20:41197055-41197077 CAAAGTCAACACATTGATCAGGG + Intronic
1177767032 21:25470812-25470834 GAAAGTGAAAACTTAGCTTTTGG + Intergenic
1178005252 21:28211861-28211883 GAAAGAGAATACTTTTATTTAGG - Intergenic
1179911035 21:44448980-44449002 GGAAGTGAGGACTTTGAGCTGGG + Intergenic
1180632951 22:17242297-17242319 GCTTGTCAACACTTTGATCTTGG - Intergenic
1184400349 22:44270324-44270346 GTAAGTGTACACATTGATCAGGG + Intronic
1184440416 22:44509243-44509265 GAATGTGGACACTTTAATTTTGG - Intergenic
949725638 3:7041169-7041191 TAAAGTGAACACTTTAATAAAGG + Intronic
952278537 3:31901533-31901555 GAAAGGGAAGACTTTGCTCAAGG - Intronic
953146330 3:40279166-40279188 CAAAGTGAACTCTTTTCTCTTGG - Intergenic
955792361 3:62601832-62601854 GAAAGTGAACACTTTGATCTGGG + Intronic
958562515 3:95765245-95765267 GAAATTGATCACTTTAATCAAGG + Intergenic
959143566 3:102516326-102516348 AAAAGTGAAAAGTTTGTTCTTGG - Intergenic
960097948 3:113706175-113706197 GAAAGTTAGCACCTTGTTCTCGG + Intergenic
960452863 3:117831840-117831862 AAAAGTCAACACATTGAGCTGGG + Intergenic
960638629 3:119807737-119807759 GGATGTGAACACTTGGATTTGGG - Intronic
961535878 3:127570226-127570248 AACAGTGGACACCTTGATCTTGG + Intergenic
961813336 3:129534424-129534446 GATAGTGAACATTTTGAGATTGG + Exonic
963270766 3:143283676-143283698 GCCAGTGAAGGCTTTGATCTTGG - Intronic
963890178 3:150626468-150626490 GAAAGTAAACATTTTGGGCTAGG - Intronic
964195651 3:154061485-154061507 CAAAGTGGATACTTTGATCATGG - Intergenic
964669950 3:159214184-159214206 GAGAGTGAACAGATTGAGCTGGG - Intronic
965504021 3:169491989-169492011 CAAAGAAAACACTTTTATCTGGG + Intronic
965524247 3:169699726-169699748 GATGGGGAACATTTTGATCTTGG + Intergenic
970167350 4:13253204-13253226 TAAAGTTAACACTTTGATCATGG + Intergenic
970810279 4:20085477-20085499 GAAAGTCTACTCTTTGATCTGGG + Intergenic
971273413 4:25172565-25172587 CAAAGTGACCACTTTGAATTTGG + Intronic
971369962 4:26010881-26010903 GGAAGTGATCACATTGAACTTGG + Intergenic
971789599 4:31152041-31152063 AAATGTGAACACTTTTAACTTGG + Intergenic
971892389 4:32542007-32542029 GAAAGGGAATATTTTGACCTAGG - Intergenic
971974862 4:33671614-33671636 GAAAGTTAACAATTTGAGTTCGG - Intergenic
972435356 4:39028555-39028577 GAAAGACAACTCTTTGATCAAGG - Intronic
973274676 4:48294128-48294150 GAAATCAAACACCTTGATCTTGG + Intergenic
975571557 4:75823110-75823132 CAAAGTTAACACTTTCATATAGG - Intergenic
976335462 4:83880167-83880189 GACAGTAAACACTATAATCTGGG - Intergenic
976893004 4:90073458-90073480 GAAAGATAACACTTGGCTCTAGG - Intergenic
980576645 4:134691033-134691055 AAGAGTGTACACTTTGATGTAGG + Intergenic
982922735 4:161296080-161296102 GAAATTGATCAATTTTATCTTGG - Intergenic
983826356 4:172266800-172266822 AATAGTGAACACTGTGATCTTGG + Intronic
984162029 4:176264644-176264666 GAAAGTGGACCCTTAGAGCTTGG - Intronic
992174505 5:74136390-74136412 TAAAGAGTACAGTTTGATCTTGG - Intergenic
992271346 5:75066815-75066837 GATAGTGATTCCTTTGATCTGGG + Intergenic
994068146 5:95566614-95566636 AAAAGTGAACAATTTGACTTGGG - Intronic
994110298 5:95995538-95995560 GAAAATGAAGATTTGGATCTTGG + Intergenic
994116065 5:96062536-96062558 GAAGATGAACACTTTTATCAAGG + Intergenic
995073574 5:107953622-107953644 GAAGGTGAAGACTTTGCTTTTGG - Intronic
995908638 5:117158173-117158195 TAGAGTGAACACTTGGTTCTTGG + Intergenic
996104844 5:119488276-119488298 GAACATGAAGACTTTGATTTTGG - Intronic
996312010 5:122117136-122117158 GAAAGTGAAAACTTAGGTGTTGG + Intergenic
997781049 5:136658815-136658837 GAAAGTGAACATCTTGACATGGG - Intergenic
999656232 5:153813094-153813116 AAAAGTGAAGAGTTTGATTTTGG - Exonic
1000217359 5:159173922-159173944 GAAAGAGAAAACTTTGATCTAGG - Intronic
1001187665 5:169591329-169591351 GATAATGAAGACTTAGATCTTGG - Intronic
1002545495 5:179940530-179940552 GAAAGTGAACAATTTGGGCCGGG - Intronic
1003516234 6:6821241-6821263 GAAAGTAAACACTTGGATCCTGG - Intergenic
1003976898 6:11353139-11353161 GAAAAATAACTCTTTGATCTTGG - Intronic
1004095373 6:12548946-12548968 GAAAGGGAACTCTTTTACCTTGG + Intergenic
1004463420 6:15861002-15861024 GAAAATGAATTCTTTGAACTGGG + Intergenic
1008964870 6:57304668-57304690 GAAACTGAAGCATTTGATCTGGG + Intergenic
1009671614 6:66760232-66760254 GAAAGAGAATAGTTTGATCAGGG + Intergenic
1010217589 6:73418427-73418449 CAAAGGGAACCCTTTGATGTAGG + Intronic
1011531465 6:88326835-88326857 CAAAGTGAAAACTGTTATCTGGG - Intergenic
1012836392 6:104274911-104274933 GATAGTGATTACTCTGATCTGGG - Intergenic
1013903883 6:115190976-115190998 GACAGCTTACACTTTGATCTTGG + Intergenic
1014715644 6:124861848-124861870 GAAAATGGACATTTTGATTTTGG - Intergenic
1015571616 6:134626870-134626892 CAAAGTGAACACTATTATCTTGG + Intergenic
1016083742 6:139886652-139886674 GAAAGAAAACACTTTGCTCCAGG - Intergenic
1020961439 7:14809055-14809077 GAAAGTGATAACTTTAATGTAGG + Intronic
1020974389 7:14987486-14987508 TAAAGAGAAAACTTTGATATAGG - Intergenic
1024949185 7:54840354-54840376 CAAAGTAAACACTTTAATCCTGG - Intergenic
1028531294 7:91841541-91841563 GAAAATGAACACAGTGATCTAGG - Intronic
1028769236 7:94597491-94597513 TAAAGTGAACACATTTACCTGGG - Intronic
1029220918 7:98989531-98989553 GAAAGGGAACAATTTATTCTTGG - Intronic
1030628111 7:111865994-111866016 GAAAGCTTACACTTTGATTTTGG + Intronic
1031371378 7:120971221-120971243 GTCAGTGGACACCTTGATCTTGG - Intronic
1031483384 7:122303652-122303674 GCAAGTGAAAACTTTGGGCTTGG + Exonic
1031576897 7:123425602-123425624 TAAAATGAACACTGTGATATTGG + Intergenic
1032334675 7:131014162-131014184 GAAACAGAATACTTTGCTCTGGG - Intergenic
1032950123 7:136899185-136899207 TAAAATGAACACTTTTATTTTGG + Intronic
1034060894 7:148087957-148087979 GAAAATGAAAACTTTTATTTTGG + Intronic
1039234353 8:35485725-35485747 GAAAATTAACACTTTGCTCAGGG - Intronic
1040452255 8:47559816-47559838 GAAAGAGAAAACTTGGATTTGGG - Intronic
1041692489 8:60702551-60702573 GAAGGTGGAGACTGTGATCTTGG + Intronic
1045546156 8:103130567-103130589 GAAATTGCACACTTTGTTCATGG + Intergenic
1047982680 8:130199256-130199278 ACAAGTCAACACTTTGCTCTAGG - Intronic
1048253810 8:132889569-132889591 CAAGGTTAACACATTGATCTTGG + Intronic
1048641586 8:136369629-136369651 AAAAGTGAAAACTTTGATAAAGG + Intergenic
1050287687 9:4119677-4119699 GAAAGTGAACGATCTGCTCTTGG - Intronic
1050585271 9:7104275-7104297 GAAACTGTACACTGTGGTCTTGG + Intergenic
1051948459 9:22601181-22601203 AAAAGTGAATATTATGATCTGGG + Intergenic
1054893350 9:70278190-70278212 GACAGTGATCATTTTCATCTTGG + Intronic
1058120489 9:101133390-101133412 GAAAGTGAACAGGTTGAATTTGG + Intronic
1058531671 9:105912058-105912080 GAAAGTGAATTCTTTGTCCTTGG - Intergenic
1058667936 9:107337438-107337460 AAAAGTGAACACCCTGAACTGGG + Intergenic
1061050825 9:128193749-128193771 GCATGTTAACACCTTGATCTGGG + Intronic
1186057791 X:5668601-5668623 AGAAGTGAACATTATGATCTAGG - Intergenic
1189886779 X:45554414-45554436 GAAAGGGAACCCTGTGTTCTTGG + Intergenic
1190996742 X:55617443-55617465 GAAAGTGAACATTTGACTCTGGG - Intergenic
1193597410 X:83463763-83463785 TAATGTGAACACTTTAATATTGG - Intergenic
1194193400 X:90864697-90864719 GAATTTGCACACTTTGTTCTAGG - Intergenic
1194775355 X:97956384-97956406 GCCAGCCAACACTTTGATCTAGG - Intergenic
1194800155 X:98263261-98263283 GAAAGTGTACAGTCTGTTCTAGG + Intergenic
1197130597 X:123001514-123001536 GAAAATGAAGATTTTGATTTTGG - Intergenic
1199302056 X:146224149-146224171 AAAACTGAGCACTTTGATGTAGG - Intergenic
1201906477 Y:19090916-19090938 GAAAATGAAGAATGTGATCTCGG - Intergenic
1201907102 Y:19096691-19096713 GAAAGAGAACACATTGCTCTGGG + Intergenic