ID: 955796071

View in Genome Browser
Species Human (GRCh38)
Location 3:62638509-62638531
Sequence ATAGAGAAGCTGAATCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 324}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955796068_955796071 15 Left 955796068 3:62638471-62638493 CCAGATGTAAGTGGCAAGTAATC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 955796071 3:62638509-62638531 ATAGAGAAGCTGAATCAGAAAGG 0: 1
1: 0
2: 0
3: 28
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955796071 Original CRISPR ATAGAGAAGCTGAATCAGAA AGG Intronic
900118535 1:1038856-1038878 AGAGAGAAGGGGAACCAGAAGGG + Intronic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
902141783 1:14362898-14362920 ATAGAGAAACTGAGGCAGGAAGG + Intergenic
902778575 1:18690356-18690378 ATAGAGAAGAGGAAGCAGAAAGG - Intronic
902989869 1:20179396-20179418 AGAGAGAAGCTGACACACAAGGG - Intergenic
903986551 1:27233579-27233601 AAAGGAAAGCTGAAGCAGAAAGG - Intergenic
905620550 1:39442183-39442205 ATGGAGAAGCTTAATCACCAGGG + Exonic
906080107 1:43080729-43080751 ATAGAGAAGCTGAATAGTACCGG + Intergenic
906251627 1:44315031-44315053 GGAGAGAAGCTGGACCAGAATGG - Intronic
906437300 1:45807213-45807235 TTAGAGAAGCAGTAACAGAATGG - Intronic
906529105 1:46512978-46513000 AGAGAGAAGGAGAAACAGAAGGG - Exonic
906824865 1:48968627-48968649 ATAGAGAAGCTGAGTCCTAGAGG + Intronic
908128816 1:61054390-61054412 AAAGAGGCGCTGTATCAGAAGGG - Intronic
908723520 1:67150695-67150717 ATAGAGATGTTGAATCAGTTGGG + Intronic
909922175 1:81395698-81395720 ATACAAAAGCTGACTCAAAATGG - Intronic
910442876 1:87270713-87270735 ATAGAGAAGTTGAAACTAAAGGG + Intergenic
910651538 1:89573672-89573694 ATAGAGAAGCAGGATCAGTGAGG - Intronic
911760606 1:101610539-101610561 ATATAAAAACTTAATCAGAAAGG + Intergenic
914386490 1:147174015-147174037 ATAGAGCTGCTCACTCAGAAAGG - Intergenic
914771214 1:150687001-150687023 ATAGGGCAACTGTATCAGAAGGG - Intronic
914943383 1:152042428-152042450 AAAGAGGAGCTGAACCAGAATGG + Intronic
915006543 1:152643338-152643360 ATAATTAAGCTGAATGAGAAAGG - Intergenic
916668703 1:166991182-166991204 ATAAATATTCTGAATCAGAAGGG - Intronic
917143521 1:171862806-171862828 AAAGAGAAGCAGCAACAGAAGGG + Intronic
917712918 1:177705374-177705396 ATACAGAAGCAGACTAAGAAGGG + Intergenic
918496111 1:185138755-185138777 ATAAAGAAGATAAAACAGAATGG + Intronic
918559405 1:185846548-185846570 TTAGAGAAGATGAATCACATTGG + Intronic
920017378 1:202923813-202923835 ATATTGCTGCTGAATCAGAATGG - Intronic
920531503 1:206705962-206705984 ACAGCGAAGCTGCACCAGAAGGG - Intronic
921239479 1:213163851-213163873 AAAGCAAAGCAGAATCAGAATGG - Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922727750 1:227931493-227931515 AAAAAGAAACTGGATCAGAAAGG - Intronic
923739112 1:236639630-236639652 ATACAGAAATAGAATCAGAAGGG + Intergenic
924009104 1:239644728-239644750 ATACAGATGGTGATTCAGAAGGG + Intronic
924805142 1:247355946-247355968 GAAGAGAAGCAGAAACAGAAAGG + Intergenic
924883171 1:248186067-248186089 ATACAGAATATGAATCTGAAAGG - Intergenic
1063849549 10:10170107-10170129 ATACAGAAGTTGATTCTGAATGG - Intergenic
1068762305 10:60725865-60725887 ATAGGGAAACTGAAACAGAATGG + Intronic
1069187174 10:65439154-65439176 ATAGAAAAGATGAATCAAAGTGG + Intergenic
1069614451 10:69798094-69798116 AAAGAGATTCTGACTCAGAAAGG + Intergenic
1070754416 10:78982730-78982752 ACAGAGAAACTGGAACAGAATGG - Intergenic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1071855361 10:89618837-89618859 AAAGTAAAGATGAATCAGAATGG + Intronic
1072324376 10:94282766-94282788 ACAGAAAAACAGAATCAGAAAGG - Intronic
1073461809 10:103669967-103669989 ATGAAGAAGCTGAACCAGAGAGG + Intronic
1073712485 10:106060166-106060188 ATTGGGAAGCTGAATCTGAGAGG - Intergenic
1074162784 10:110847662-110847684 GTAGAGCAGCTCAATCAGCAGGG + Intergenic
1074204892 10:111274532-111274554 AAAGTTAAGATGAATCAGAAAGG + Intergenic
1077563177 11:3278687-3278709 TGAGAGAACCTGAATCAGGAAGG - Intergenic
1077569070 11:3324503-3324525 TGAGAGAACCTGAATCAGGAAGG - Intergenic
1077828152 11:5832603-5832625 ATACAGAATCTCAATTAGAAAGG + Intronic
1078585339 11:12581674-12581696 TTAGAATAGCTGAATGAGAAAGG + Intergenic
1078758871 11:14235775-14235797 ATAGGGATGCTGAGTCAAAAAGG + Intronic
1079725221 11:23872166-23872188 ACAGCGAAACAGAATCAGAATGG - Intergenic
1079861725 11:25680888-25680910 GTTGGGAAGCTTAATCAGAATGG + Intergenic
1081930977 11:46871204-46871226 ATAGAGAAGCTGCTTCATGAGGG - Intronic
1082705665 11:56491621-56491643 AAACAGAAGCTGAATTTGAAGGG - Intergenic
1082706728 11:56501532-56501554 AGACAGAAGCTGAATTAGAAGGG - Intergenic
1082986485 11:59173978-59174000 GTAGAGAAGATGACTCGGAAAGG + Intronic
1085207467 11:74744810-74744832 CTAGGGAAGCTGAACCTGAAGGG - Intergenic
1085277496 11:75309390-75309412 ACAGAGAAGGTGCATCATAAAGG + Intronic
1086382850 11:86275681-86275703 TTAGAGACTCTGAATCAGTAGGG + Intronic
1086867975 11:92003252-92003274 AGAGAGAAGCAGAAGCAGAGAGG + Intergenic
1086879447 11:92136545-92136567 ATAAAGAATCTGAAACATAATGG - Intergenic
1086881095 11:92154353-92154375 ATAGGGAATTTGAATGAGAATGG - Intergenic
1086994083 11:93336686-93336708 CTGGAGAAGCTAAAACAGAAAGG - Intronic
1087949637 11:104204877-104204899 ATACAGAAGGAGGATCAGAAGGG - Intergenic
1088246109 11:107819865-107819887 ATGGAGAAGATGACTCAGAGTGG + Intronic
1090877150 11:130800977-130800999 ATAGAGAATCTAAAACAGCATGG - Intergenic
1091916374 12:4273869-4273891 AGAGAGAAGGTGGAGCAGAAGGG - Exonic
1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG + Intergenic
1092482121 12:8869121-8869143 CTGGAGAAGCTGAATAAGAGAGG - Exonic
1092734094 12:11563168-11563190 AGAGAGAAGCTGAGTCATAATGG + Intergenic
1093786428 12:23196773-23196795 ATAGAAATGCTGAAAAAGAAAGG - Intergenic
1094381217 12:29845297-29845319 ATGAAGAAACTGAAACAGAAAGG + Intergenic
1096876250 12:54632622-54632644 ATAGAGAAGCTGGATCTTGAAGG + Intronic
1097819214 12:64110663-64110685 ATGGAGATTCTGAATAAGAATGG - Intronic
1098642797 12:72858815-72858837 ATACCCAAGCTGAATTAGAATGG + Intergenic
1101112898 12:101503873-101503895 GTAGATAACTTGAATCAGAATGG - Intergenic
1101533584 12:105596751-105596773 ATAGACAATAAGAATCAGAAAGG + Intergenic
1101719332 12:107337575-107337597 ATTGAGGAGCTGACTCAGAGAGG + Intronic
1102255612 12:111413130-111413152 ATGGGGAAGCTGAAACAGAGCGG - Intronic
1104496600 12:129246400-129246422 AAAGAGAAGCTGAACCTGACGGG + Intronic
1105040923 12:132960583-132960605 AAAGAGATGCAGAAGCAGAAGGG - Intergenic
1105259958 13:18771778-18771800 ATATAGAAGCAGGTTCAGAAGGG - Intergenic
1106788932 13:33135095-33135117 CTAGAGAAGAGTAATCAGAATGG + Intronic
1108070369 13:46622854-46622876 TTAAAGAAGCTGAAGCAAAAAGG - Intronic
1109144535 13:58762064-58762086 ATAAAGGTGCTGAGTCAGAAGGG + Intergenic
1111480656 13:88821302-88821324 ATAGAGAAGATGGGACAGAAGGG + Intergenic
1114133835 14:19823998-19824020 ATAGGGAAGATGAAGGAGAAGGG - Intronic
1114135797 14:19848202-19848224 ATAGATAAGTGGATTCAGAAAGG - Intergenic
1116805464 14:49490170-49490192 CTAGAGGAGCTGTCTCAGAAGGG - Intergenic
1117162883 14:53006476-53006498 ACACAGAAACTGACTCAGAATGG + Intergenic
1120145981 14:80978804-80978826 AAAGAGAAGCTGGTACAGAAAGG - Intronic
1120784126 14:88515227-88515249 ATAGAGAAGTTGTATCGGTAAGG - Intronic
1121511318 14:94515228-94515250 AAAGAGAAGCAGAATCACAAGGG + Intronic
1123576906 15:21679585-21679607 ATAGGGAAGATGAAGGAGAAGGG - Intergenic
1123613528 15:22122053-22122075 ATAGGGAAGATGAAGGAGAAGGG - Intergenic
1125222016 15:37349479-37349501 ATGCAGAAGGGGAATCAGAACGG + Intergenic
1125355126 15:38809465-38809487 ACAGAGAAGAAGGATCAGAAAGG - Intergenic
1125509567 15:40285667-40285689 AAAGAGAAGTTGAGTCATAAAGG - Intronic
1127140880 15:55975262-55975284 AAAGGGAAGCTAAATTAGAAAGG + Intronic
1127229906 15:56979622-56979644 AGAGAGTATGTGAATCAGAAGGG + Intronic
1127437669 15:58974016-58974038 ATAGAGAAGGGGAATCCAAATGG - Intronic
1128951910 15:71893715-71893737 ATAAAGAAGATGAACCAGCATGG - Exonic
1131400944 15:92125284-92125306 TTAGATGAGATGAATCAGAATGG + Intronic
1202985774 15_KI270727v1_random:413830-413852 ATAGGGAAGATGAAGGAGAAGGG - Intergenic
1134306046 16:13033452-13033474 TTAGAGAAGCAGAAAAAGAAAGG - Intronic
1137702451 16:50506775-50506797 ATAGAGAAGCTGAAGCCCCATGG - Intergenic
1139713532 16:68794625-68794647 TTAGAGAGGCTGAGGCAGAAGGG - Intronic
1141077299 16:81018925-81018947 AAAGGGAAGCTGAATCAGAGGGG + Intronic
1142023210 16:87797004-87797026 AGAGATAAACTGAAGCAGAAAGG + Intergenic
1143097929 17:4488363-4488385 ATGGAGAAGCTGGGTCAGAGTGG - Intergenic
1144001127 17:11056176-11056198 AAAGAGAAGGAGAAACAGAAAGG - Intergenic
1144100426 17:11937781-11937803 GCAGAGAAGCTGAATAAAAATGG - Intronic
1146483870 17:33227759-33227781 ATAAAGAAACTGAAGCACAAAGG + Intronic
1146637284 17:34515733-34515755 AAAGAGAAGCTGAAAGAGAAAGG - Intergenic
1147778678 17:42923497-42923519 ATGGATAACCTGAATCTGAAAGG - Intergenic
1148657103 17:49293924-49293946 ATACAGTAGCTCAAACAGAAAGG + Intronic
1149085943 17:52716121-52716143 ACAGAGAAGCTGAATATGTATGG - Intergenic
1149668845 17:58387179-58387201 ACAGAGAAGCTGAGTCAGTCTGG + Intronic
1149795434 17:59514799-59514821 GAAGAGAGGCTGAATCAGAAAGG + Intergenic
1151115547 17:71730879-71730901 GTAAAGAAACTGAGTCAGAAAGG + Intergenic
1153461267 18:5336176-5336198 ACAGAGAAGATGAATCACAAAGG + Intergenic
1154032530 18:10766279-10766301 AGAGAGAAGGGGAAGCAGAAAGG + Intronic
1154459887 18:14571682-14571704 ATAGATAAGTGGATTCAGAAAGG - Intergenic
1155102492 18:22626127-22626149 AGAGAGAAGCTGAATAGAAAAGG + Intergenic
1156558470 18:38094047-38094069 AGAGAGAAAATGAATAAGAAGGG - Intergenic
1156648331 18:39194685-39194707 ATAGAAATGCTTAATCAGATGGG + Intergenic
1157149116 18:45197252-45197274 ATAGAACAGGTGAATGAGAAAGG - Intergenic
1157400426 18:47382423-47382445 AGAGAGAAGCTGCAGCAGAAAGG - Intergenic
1157654165 18:49369109-49369131 ATAGAGAAAATGAACCAAAACGG - Intronic
1157951326 18:52041455-52041477 TGAGAGAAGCTCAATCAGACTGG - Intergenic
1158480589 18:57818187-57818209 AGAGAGAAGTTGAAACAGAGTGG - Intergenic
1159513161 18:69422450-69422472 ATAGAGTAGCTGGTTCAGGAGGG - Intronic
1159873759 18:73787733-73787755 AGAGTGAAGCTGAATCTGCAGGG - Intergenic
1161672956 19:5624199-5624221 ATAGAAAAGAGGACTCAGAAGGG - Intronic
1161772074 19:6236349-6236371 ATGAAGATGCTGAATCAGACAGG + Intronic
1163791965 19:19312236-19312258 AAAGAAAAACTGAAACAGAAAGG + Intronic
1164610403 19:29627868-29627890 AGAGAGAAGCTGACTCTGCATGG + Intergenic
1164789057 19:30960528-30960550 ATAAAAAAGTTGAATCAGATTGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
925247994 2:2401884-2401906 ATAGAACAGGAGAATCAGAAAGG - Intergenic
925909055 2:8560306-8560328 ATACAGAAGCTGAAAGTGAAGGG + Intergenic
926111192 2:10184820-10184842 ATGGGGAAACTGAGTCAGAAAGG + Intronic
926580102 2:14625600-14625622 ACAAACAAGCTTAATCAGAAAGG + Intergenic
927766180 2:25810540-25810562 AGCGAGAAGCTGAAGGAGAAAGG - Intronic
928327376 2:30330194-30330216 ATGGGGAAGCTGAATCACAAAGG - Intergenic
928634510 2:33229364-33229386 ACTGAGAAGCTGAGGCAGAAGGG + Intronic
930321008 2:49854456-49854478 CTCGAGAGGCTGAAGCAGAACGG + Intergenic
932748742 2:74357263-74357285 ATACAGAAACTGAAGCTGAAAGG + Intronic
933761971 2:85678789-85678811 AAAGAGAAGCTGATTCTGACTGG + Intergenic
934074250 2:88414187-88414209 ATACACAAAATGAATCAGAAAGG + Intergenic
934155131 2:89192157-89192179 ATAAAGAAGAAGAATTAGAAAGG - Intergenic
934212183 2:89990570-89990592 ATAAAGAAGAAGAATTAGAAAGG + Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
938125318 2:128666879-128666901 AAAAAGAAGCTGAGTTAGAAGGG - Intergenic
938419759 2:131135706-131135728 CTAGAGAGGCTGAGGCAGAATGG - Intronic
939087116 2:137734417-137734439 ACACATAAGCTGAATTAGAAGGG - Intergenic
940368343 2:152873735-152873757 ATTGGGAAGCTGAAGCAGGAGGG + Intergenic
940577595 2:155530768-155530790 AAAGAGCATCTAAATCAGAAAGG + Intergenic
941236458 2:162981578-162981600 ATAAAGAATATGAATCAAAAGGG - Intergenic
941762947 2:169264874-169264896 CTGGAGGAGCTGAAGCAGAATGG + Intronic
941915069 2:170806534-170806556 ATAGAAAATCTGAAGCAAAATGG - Intergenic
942398045 2:175572903-175572925 ATAGACAGACTGAATCAGACAGG + Intergenic
942757368 2:179357918-179357940 ATACAGAAGCTATTTCAGAAAGG + Intergenic
943173213 2:184431688-184431710 ATGTAGAAGAGGAATCAGAATGG + Intergenic
946695794 2:222357784-222357806 AAAGAGAAGGTGAAAGAGAAAGG - Intergenic
947252678 2:228125495-228125517 TTAGAGAATCTGAGTCAGACAGG + Intronic
1168828102 20:827669-827691 ATAATTAAGCTGATTCAGAAGGG - Intergenic
1168958207 20:1849341-1849363 ATAGTGCAGCTGAATAAGGAGGG - Intergenic
1169506071 20:6213132-6213154 AGAGAGGAGCTGACTCAGCAGGG + Intergenic
1169605283 20:7311047-7311069 AGAGAGAAGCTGAAGAAGAGAGG - Intergenic
1169859573 20:10137099-10137121 ATAGAGCAGGTGAGTCAGAAAGG + Intergenic
1170036297 20:11993727-11993749 CTCGGGAAGCTGAAGCAGAATGG - Intergenic
1170105037 20:12745985-12746007 ATTGAAATGCTGAATCAGAGTGG - Intergenic
1170117005 20:12871358-12871380 ATAGGTAAGCTGAAGCAGTATGG - Intergenic
1170363465 20:15573717-15573739 ATAGGGAAGGAGATTCAGAAGGG - Intronic
1171351667 20:24507346-24507368 ATATAGATGATGAATCAGAAAGG - Intronic
1171883582 20:30635384-30635406 ATATAGAAGCAGGTTCAGAAGGG - Intergenic
1172065607 20:32218030-32218052 TTAGAGAAATTGAAGCAGAAAGG + Intronic
1172214347 20:33224470-33224492 ATACAGAAGCAGAATCTGAGAGG + Intronic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1174072636 20:47909633-47909655 ATAGAGCAGGGGCATCAGAAGGG - Intergenic
1176545664 21:8196919-8196941 AGAAAGAAGCTCAATCAGAGAGG - Intergenic
1176564615 21:8379964-8379986 AGAAAGAAGCTCAATCAGAGAGG - Intergenic
1176814229 21:13581144-13581166 ATAGATAAGTGGATTCAGAAAGG + Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1177271736 21:18857579-18857601 ATAAAAAAGCAGTATCAGAAGGG + Intergenic
1177522746 21:22250575-22250597 AAAGAGAGCCTGAATCAGAAAGG + Intergenic
1177629263 21:23705375-23705397 ATAGACATGTTCAATCAGAATGG - Intergenic
1178062549 21:28868103-28868125 ATAAATAAACTGAAACAGAATGG - Intergenic
1178205930 21:30465079-30465101 ATAAAGAAACTGAATCAGAGAGG - Intergenic
1180595512 22:16970380-16970402 ATGGAGAAACTAATTCAGAAAGG - Intronic
1181685722 22:24526581-24526603 CTAGAGAAGCAGAACCAGTAGGG - Exonic
1182462539 22:30492577-30492599 CTTGAGAAGCTGGACCAGAAAGG + Intronic
1182932467 22:34188224-34188246 AATGAGAACTTGAATCAGAATGG - Intergenic
1183174211 22:36210870-36210892 ATTGGGAGGCTGAAGCAGAAGGG - Intergenic
1183786441 22:40031594-40031616 ATGGAGAAACTGAGGCAGAAAGG - Exonic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1185353111 22:50348544-50348566 ATAGGGAAGCTGAATTAGGGTGG + Intronic
1203250535 22_KI270733v1_random:113156-113178 AGAAAGAAGCTCAATCAGAGAGG - Intergenic
949708289 3:6843528-6843550 AGAGACAAGCTGAATCAGTAGGG + Intronic
952563062 3:34618509-34618531 ATAGAGAAGCTGAATGAATAAGG - Intergenic
955453228 3:59093021-59093043 AGACAGAAGCTGAATCATAGTGG - Intergenic
955796071 3:62638509-62638531 ATAGAGAAGCTGAATCAGAAAGG + Intronic
956605306 3:71067450-71067472 TTAGAAAAGCTGAATAAGAAAGG + Intronic
956726795 3:72163079-72163101 ACAGAGAAGATGATTAAGAAAGG + Intergenic
957341675 3:78906407-78906429 GGAGAGAAGCTGCATCATAAAGG - Intronic
957910727 3:86617884-86617906 ATCCAGTATCTGAATCAGAATGG + Intergenic
958055071 3:88399733-88399755 TTAGCGAAGCTGAACAAGAAAGG + Intergenic
958101406 3:89016063-89016085 AAAAAGAATATGAATCAGAATGG - Intergenic
958259768 3:91367058-91367080 ATAGGGAAACTGAAGCAGGAGGG + Intergenic
958898030 3:99852220-99852242 ATACAGAAGCTAAAATAGAATGG + Intronic
960052596 3:113252527-113252549 ATGGAGAAGCAGTAACAGAATGG + Intronic
962569989 3:136703358-136703380 ATCAGCAAGCTGAATCAGAAAGG - Intronic
962739651 3:138353873-138353895 TGAGAGAAGCAGAGTCAGAAAGG + Intronic
963465182 3:145670438-145670460 ATAGAGAAGCAGAACCAGTAGGG - Intergenic
963922722 3:150921520-150921542 GTAGGGAAGGAGAATCAGAATGG - Intronic
964057357 3:152477655-152477677 GTACAGAAGCTGGATGAGAAAGG - Intergenic
965233159 3:166079363-166079385 ATAAAAAAGCTGAATGTGAAGGG + Intergenic
965642514 3:170845064-170845086 ATAGTGAAACTAAATCAAAATGG - Intronic
967066913 3:185926360-185926382 ATAAAGAAGCTAAAGCTGAAAGG + Intronic
967383701 3:188888837-188888859 ATAAAGAAGCTGTATCAGCAAGG - Exonic
971320380 4:25600694-25600716 ATAGAGAGGCTGGAGAAGAAGGG + Intergenic
972766210 4:42153687-42153709 ATACAGAAGCTGAACCAGCAAGG - Intergenic
974467277 4:62273405-62273427 ATGGAGAACCTGAATCTGGAAGG - Intergenic
975143877 4:70946360-70946382 ACACAGAAGCTGAAACATAACGG - Intronic
975319498 4:72994403-72994425 AAAGAGAAGCTGATTCAGGTGGG - Intergenic
975514653 4:75233266-75233288 AGTGAGAAGCTGTCTCAGAAAGG - Intergenic
975875485 4:78831033-78831055 ATAGTTAAGCTTAATGAGAAAGG - Intronic
976120649 4:81777462-81777484 AGAAAGAAACAGAATCAGAAAGG + Intronic
979194211 4:117900576-117900598 ATACAGAAGCAGACACAGAAGGG - Intergenic
979737784 4:124109164-124109186 ATATAGAAGCTAAAGCAGAGAGG - Intergenic
979957027 4:126966787-126966809 ATAGAGAAAGTGAGTGAGAATGG - Intergenic
980408535 4:132384308-132384330 TTAGCAATGCTGAATCAGAAGGG - Intergenic
980511919 4:133803168-133803190 ATAGAGAAAGTGTAACAGAAAGG + Intergenic
981119318 4:141030764-141030786 TTATAGAAACAGAATCAGAATGG + Intronic
981613614 4:146622874-146622896 ACACAACAGCTGAATCAGAAAGG - Intergenic
982953900 4:161737829-161737851 ATAAAGTAGTTGATTCAGAAAGG - Intronic
983313415 4:166095767-166095789 AAAATGAAGCTGAATAAGAAAGG - Intronic
983313789 4:166099913-166099935 AAAGAGAATGTGAATTAGAATGG - Intronic
983954192 4:173677734-173677756 ATATAGAAGGTGAATGAGCAAGG + Intergenic
983970126 4:173861328-173861350 AAAGAGAAACTAAATCACAAAGG - Intergenic
984019418 4:174466806-174466828 ATAGATAAGCTGAAATACAACGG + Intergenic
984199768 4:176703889-176703911 CATGAGAAACTGAATCAGAAAGG - Intronic
986385219 5:7226727-7226749 ATAGAGAACCTCAAAGAGAATGG - Intergenic
987631871 5:20483764-20483786 ATAGATCAGTTCAATCAGAATGG + Intronic
987656250 5:20810465-20810487 GAAGAGAAATTGAATCAGAAAGG - Intergenic
988176608 5:27734614-27734636 ATAGAGAAGTTGAAAGAGACTGG + Intergenic
988767306 5:34393475-34393497 GAAGAGAAATTGAATCAGAAAGG + Intergenic
989440774 5:41470563-41470585 ACAGAGAAGTTGATCCAGAAGGG + Intronic
991081464 5:62605417-62605439 AGAGAGAGGCTGAATGAAAAGGG - Intronic
992004252 5:72461935-72461957 ATTGAAAAGCTGCAGCAGAATGG - Intronic
992240212 5:74761400-74761422 AGTCAGAAGCTGAGTCAGAAAGG + Intronic
992550915 5:77858937-77858959 TTAGAGATGTTGAACCAGAAGGG + Intronic
992754230 5:79889171-79889193 AAGGAGAAGCTGTAGCAGAATGG + Intergenic
993213514 5:84987307-84987329 ATAGAGAAGCTGACCTATAATGG + Intergenic
996331969 5:122339891-122339913 AGAGAAAAGATGAATGAGAATGG + Intronic
996413909 5:123188810-123188832 ATAGAGAAGCAAAATTAAAAGGG - Exonic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
998511110 5:142714700-142714722 GGATAGAAGCTGAATCAGCAAGG - Intergenic
998680054 5:144457231-144457253 AGAGAGAAGATGAATAAGCATGG + Intronic
999625194 5:153513205-153513227 AAACAGAAGCTTAAGCAGAAGGG + Intronic
1000628230 5:163563680-163563702 ACAGATAAGTTGGATCAGAAGGG + Intergenic
1000670810 5:164060857-164060879 ATAGAGAACCAGAAGCAGATGGG - Intergenic
1000683952 5:164223835-164223857 TCAGAGAAGATGAAGCAGAAAGG + Intergenic
1002051506 5:176574164-176574186 ATAGAGAAGGTGAGTGTGAAGGG + Exonic
1003333061 6:5145562-5145584 ATAAAAAAGCTTCATCAGAAGGG + Intronic
1005109188 6:22260452-22260474 ACACAGGAGCTGAATCAGATGGG + Intergenic
1006126302 6:31840864-31840886 AAAGAGAAATTGAATCAGACAGG - Intergenic
1008164020 6:48113565-48113587 ATAGAGAAGATTATTCTGAAGGG - Intergenic
1008549649 6:52615555-52615577 TGAGAGAATTTGAATCAGAATGG + Intergenic
1008672996 6:53793062-53793084 ACAGAGAAGCTGAAGCATCATGG + Intergenic
1009690851 6:67030684-67030706 ATACAGAAGCTAACTCAAAATGG - Intergenic
1009942984 6:70310694-70310716 ATAAATAAGATGAGTCAGAAAGG - Intergenic
1014536854 6:122624326-122624348 ATAAAGAAGCTTGATCAAAAAGG - Intronic
1015072106 6:129106957-129106979 CCAGAGAAACTGAATGAGAATGG + Intronic
1015907637 6:138133948-138133970 ATACAGAAATTAAATCAGAATGG + Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016710233 6:147163251-147163273 CTTGGGAGGCTGAATCAGAATGG - Intergenic
1016929276 6:149387265-149387287 ATATAGAAATTGCATCAGAATGG - Intronic
1017330458 6:153192300-153192322 ATAGAGAAGATAAATAAGATGGG - Intergenic
1017540001 6:155391301-155391323 ATAGAGGAGTAGAATCTGAATGG + Intergenic
1021321170 7:19214083-19214105 ATAGAGGAGATGGATTAGAAAGG - Intergenic
1021432672 7:20578723-20578745 TGGGAGAAGCTGAATGAGAAAGG - Intergenic
1021899714 7:25272490-25272512 CTATAGAAGCTGAATCATCAAGG + Intergenic
1021981012 7:26055644-26055666 AGAGAGAAGCTGAAAGTGAATGG + Intergenic
1023694698 7:42832916-42832938 ATGGAGAAGGTGAATATGAAAGG + Intergenic
1024358769 7:48445856-48445878 ACAGACCAGCTGAATGAGAAGGG + Intronic
1024507187 7:50171812-50171834 CTAGAGAAGCAGAACCAGTAAGG - Intergenic
1024524716 7:50338098-50338120 ATAGAGAAATTGGACCAGAAAGG + Intronic
1024773996 7:52760984-52761006 TTAGAGAAGCAGAATTTGAAAGG + Intergenic
1026211229 7:68307182-68307204 ACAGGGAAGCTGAATCTGTAAGG - Intergenic
1028247918 7:88504346-88504368 ATAGAAAAACTGAATCAAAATGG - Intergenic
1028296122 7:89133800-89133822 ATAGAAAAGATAAATCATAATGG + Intronic
1028661307 7:93279399-93279421 ATAGAGGAGCTGAATAAAGAAGG + Intronic
1028829231 7:95308877-95308899 ACAGAGAATCCTAATCAGAAAGG - Intronic
1030350010 7:108474192-108474214 ATAGAAAATATGAATCAGAAAGG - Intronic
1030396013 7:108987957-108987979 ACAGAGAAACTGAAGAAGAATGG + Intergenic
1030509528 7:110467495-110467517 ATTGTAAAGCTGAAACAGAAGGG + Intergenic
1033250686 7:139755881-139755903 ATACAGAAGCAGTATCTGAAGGG - Intronic
1033497811 7:141917313-141917335 TTAGAGAAGCTGAGTGGGAAGGG + Intronic
1035549155 8:506850-506872 GTAGAGAAGCTTAAACATAAGGG + Intronic
1035594425 8:844212-844234 GAAGTGAAGCTGAATCAAAATGG + Intergenic
1036452788 8:8883176-8883198 AAAGAAAAGCTGAACCAGAGAGG + Intronic
1036507925 8:9372604-9372626 AGAGAGATGCAAAATCAGAATGG - Intergenic
1037874371 8:22533173-22533195 ACAGAAAACCTAAATCAGAATGG + Intronic
1037958183 8:23074916-23074938 AGAGAGAAGGAGAATGAGAAGGG - Intergenic
1038405949 8:27323102-27323124 AAAGAGAACCTGAACCAGGATGG + Intronic
1039422827 8:37458963-37458985 ATAGAGAACCTCACTCAAAATGG + Intergenic
1039567335 8:38560719-38560741 AAAGAGTAGCTGGAGCAGAATGG - Intergenic
1041296633 8:56363368-56363390 ACAGAGACGTTGATTCAGAAAGG - Intergenic
1041588147 8:59545557-59545579 ATATACAAAGTGAATCAGAAGGG + Intergenic
1041943651 8:63417610-63417632 AAAGTGAAGATGAATGAGAAAGG - Intergenic
1042125390 8:65533192-65533214 AGAGAGAAGATGAAGCAGAGAGG - Intergenic
1042893653 8:73642178-73642200 ATAGAGAAGCAGTAGGAGAAAGG - Intronic
1043090610 8:75897722-75897744 ATACAGAAGCTAAATGAGATTGG - Intergenic
1044083335 8:87912286-87912308 ATGTAGAAGCTGAATTGGAAAGG + Intergenic
1044230266 8:89767382-89767404 ATAGAGAAGTTGAAACAACAGGG + Intronic
1044382587 8:91551818-91551840 AGAGAGAAGTGGAATCATAAAGG - Intergenic
1046290951 8:112160019-112160041 AAAGAAAAGCTGAATCAGGAAGG - Intergenic
1047179001 8:122569261-122569283 ACAGAGAAGCTGGATCTGAAAGG + Intergenic
1047427364 8:124758778-124758800 TTAGAGAAGCTGGATCTGGAAGG + Intergenic
1047838941 8:128726492-128726514 ATATAGAAATTGAATCAAAATGG + Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048816861 8:138342278-138342300 ATAGAGAAAATGAACCAGAGAGG + Intronic
1049373984 8:142280479-142280501 AGAGAGTAGCTGAGACAGAAGGG - Intronic
1049703735 8:144027599-144027621 ATACAAAAGTTAAATCAGAATGG - Intronic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1051283860 9:15474084-15474106 AGAAAGAAGTTGAATCAAAAAGG - Exonic
1051856898 9:21577821-21577843 ATACAGAAGCTGGACCACAAAGG + Intergenic
1052183760 9:25564283-25564305 AAGGAGAAGCTGGATAAGAATGG + Intergenic
1052705003 9:31983937-31983959 GTAGAGAAGATGGATCACAAAGG - Intergenic
1061485551 9:130918838-130918860 AGAGAGAAACAGACTCAGAAAGG - Intronic
1203466937 Un_GL000220v1:96428-96450 AGAAAGAAGCTCAATCAGAGAGG - Intergenic
1185479843 X:438097-438119 AACGTGATGCTGAATCAGAAAGG + Intergenic
1186117340 X:6318719-6318741 ATAGAGAAGCTGTGAAAGAAAGG - Intergenic
1186476095 X:9858814-9858836 ATAAAAAAGCTGAGTGAGAAGGG + Intronic
1187566783 X:20458437-20458459 ATAGTGAAGTTATATCAGAAGGG - Intergenic
1187808677 X:23150738-23150760 ACAGAGAAGGTGAACCAGACTGG - Intergenic
1187953827 X:24496254-24496276 AGAGAGAATCTGAATGACAATGG - Intronic
1189841657 X:45085527-45085549 ATAGGGAAACTGAGTCAGAATGG + Intronic
1190569581 X:51768058-51768080 AAAGAGAGACTGAATAAGAAAGG - Intergenic
1193191673 X:78578648-78578670 ATACACACGCTGAGTCAGAAGGG + Intergenic
1193746399 X:85287547-85287569 ATAGATAATCTGAATAAGTATGG + Intronic
1193792705 X:85835086-85835108 ATAGAGAAGAAGAAGCAAAAAGG - Intergenic
1194484309 X:94468861-94468883 ATAGAGAAACTGGAACAGCATGG + Intergenic
1195664215 X:107413910-107413932 ATGGAGAAACTGAATCCGAGAGG - Intergenic
1197699833 X:129590974-129590996 AGAGAGAATCACAATCAGAATGG + Exonic
1202045105 Y:20729945-20729967 ATATGGAACCTGAATGAGAATGG + Intergenic
1202064047 Y:20918684-20918706 AGAGAGAAGCTCAGTCAGAGAGG - Intergenic