ID: 955797316

View in Genome Browser
Species Human (GRCh38)
Location 3:62650984-62651006
Sequence TCTCCAAGTTGGCCATGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955797310_955797316 1 Left 955797310 3:62650960-62650982 CCCCGCCTTTGGATACCGGCATG 0: 1
1: 0
2: 1
3: 1
4: 26
Right 955797316 3:62650984-62651006 TCTCCAAGTTGGCCATGAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 158
955797313_955797316 -4 Left 955797313 3:62650965-62650987 CCTTTGGATACCGGCATGCTCTC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 955797316 3:62650984-62651006 TCTCCAAGTTGGCCATGAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 158
955797312_955797316 -1 Left 955797312 3:62650962-62650984 CCGCCTTTGGATACCGGCATGCT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 955797316 3:62650984-62651006 TCTCCAAGTTGGCCATGAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 158
955797311_955797316 0 Left 955797311 3:62650961-62650983 CCCGCCTTTGGATACCGGCATGC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 955797316 3:62650984-62651006 TCTCCAAGTTGGCCATGAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955797316 Original CRISPR TCTCCAAGTTGGCCATGAGC AGG Exonic
902663433 1:17921327-17921349 TCTCCCAGTTGGCACTGAGCAGG - Intergenic
903008529 1:20314407-20314429 TCCCCAGGTTGGCCACGAACAGG - Exonic
904214309 1:28907260-28907282 TCCCCATGTTGGTCATGGGCTGG + Intronic
904546155 1:31274432-31274454 TCACCATGTTGGCCATGGCCAGG + Intronic
905872468 1:41412979-41413001 TCACCGAGATGGCCCTGAGCAGG + Intergenic
907159789 1:52361590-52361612 TCTCGATGTGGGCCATGGGCAGG + Exonic
909060513 1:70873844-70873866 TCACCATGTTGGCCAGGAGGGGG + Intronic
916807010 1:168269154-168269176 TCTGCAAGTAGTCCTTGAGCTGG + Intergenic
917204974 1:172562527-172562549 TCACCATGTTGGCCATGGCCAGG + Intronic
917586442 1:176431991-176432013 TCTACAAGTGGAGCATGAGCTGG + Intergenic
918584915 1:186175642-186175664 TCACCAATTTGGCCACCAGCTGG + Intronic
918668966 1:187188979-187189001 TCTCCAATTTGGCAATGAACAGG + Intergenic
921971361 1:221152786-221152808 TCTCCTAGTTGACCATTAGTTGG + Intergenic
1063543271 10:6955707-6955729 TCTCCAGGGTGGCCTTCAGCGGG - Intergenic
1065988758 10:30985263-30985285 TCTTTAAGCTAGCCATGAGCAGG - Intronic
1067346885 10:45443731-45443753 TCCCCAAGTCGGTCAAGAGCCGG + Exonic
1069891913 10:71657227-71657249 CCTGCAGGTTGGCCTTGAGCCGG + Intronic
1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG + Exonic
1071144993 10:82558247-82558269 TCACCAGCTTGGCCATTAGCAGG + Intronic
1073115308 10:101088431-101088453 TCTCAAAGAGTGCCATGAGCTGG - Intergenic
1073862257 10:107760394-107760416 TCTCCAAGTTACCCAAGAGAAGG - Intergenic
1075196311 10:120362332-120362354 TCACAAGGTTTGCCATGAGCTGG + Intergenic
1075402876 10:122173484-122173506 TCTGGAAGTTGCCCAGGAGCAGG - Intronic
1075499408 10:122958828-122958850 TCCCCAAGATGGCCATGCCCTGG - Intronic
1075604432 10:123794083-123794105 CCTCCAAGTCGGCCAAGAGCAGG - Intronic
1081614321 11:44581633-44581655 ACTCCAGGTTGGCCCGGAGCTGG - Intronic
1084272896 11:68038581-68038603 TCTCCAGGGTGGTCAAGAGCAGG + Intergenic
1084532243 11:69734326-69734348 TAAGCAAGTTGGCCATGGGCTGG + Intergenic
1084556098 11:69876848-69876870 TCTCCATGTTGGTCATGGTCAGG - Intergenic
1085238232 11:75031640-75031662 TCCCCAAGCTGGCCAGGAGGAGG + Intergenic
1085643142 11:78205934-78205956 TGTCTGACTTGGCCATGAGCCGG - Exonic
1091346417 11:134857196-134857218 TGGCCAGGTTGGCCTTGAGCAGG - Intergenic
1091558480 12:1593787-1593809 TCTCGATGTTGGCCATGCCCTGG + Exonic
1095764606 12:45881031-45881053 ACTACAACTAGGCCATGAGCTGG - Intronic
1096474500 12:51899913-51899935 TCACCATGTTGGCCATGGTCAGG - Intergenic
1096634926 12:52952112-52952134 TCTCCAAGCTGGCCTTCTGCAGG - Exonic
1100496359 12:95128774-95128796 TATATAAGTTGGCCCTGAGCTGG - Intronic
1101683776 12:106996039-106996061 TCTCCATGTTGGTCAGGGGCTGG + Intronic
1102236749 12:111298556-111298578 TCTCCAGGTTGGTCATGATCAGG - Exonic
1103685628 12:122730043-122730065 TCTTCACGTTGGCCATGAACAGG - Exonic
1104657259 12:130582550-130582572 TCTCTAAGCTGGCCAGCAGCTGG - Intronic
1106788100 13:33127407-33127429 TCTCCATGATGGCCGTGAGGCGG + Exonic
1110805807 13:79752954-79752976 TCTCCAAGTCTGACATGAGTGGG - Intergenic
1111817505 13:93172285-93172307 TCCCCAAGTTGGCCAACAGGGGG + Intergenic
1114481690 14:23039646-23039668 TCTCCAACTTTCCCATGACCAGG + Intergenic
1114644812 14:24249453-24249475 TGTCCAAGCTGGCAATGAGCTGG + Exonic
1115458796 14:33635771-33635793 TCTCCAAGTTGGCAGGGAGTGGG - Intronic
1117992856 14:61451946-61451968 CCTACAAGTTATCCATGAGCTGG - Intronic
1122060772 14:99135342-99135364 CCTCCCATTTGGACATGAGCTGG + Intergenic
1122997426 14:105272800-105272822 TCTTCAAGATGGCCGTGAGCAGG - Exonic
1124332227 15:28830746-28830768 TCACCATGTTGGCCATGGCCAGG - Intergenic
1125108574 15:36003775-36003797 TCCCCAAAATGTCCATGAGCAGG + Intergenic
1126681193 15:51203691-51203713 CCTCCAATTTCGCAATGAGCAGG + Intergenic
1130383896 15:83394628-83394650 TCACCACGTTGGCCAGGAGATGG - Intergenic
1130635657 15:85617440-85617462 TCGCCATGTTGGCCACGATCTGG + Intronic
1132333606 15:101029185-101029207 TCTCAAACTTGGCCAGGAACTGG - Exonic
1132946947 16:2537109-2537131 TCACCATGTTGGCCAGGGGCTGG - Intergenic
1133457434 16:5954736-5954758 TCTGCAATTTGGCCAAGTGCCGG - Intergenic
1133463940 16:6011795-6011817 TCTCCAAGTTGGAGACGAGGAGG + Intergenic
1136011182 16:27364205-27364227 CCTCCACGTGGGCCATGATCTGG - Exonic
1139929933 16:70518126-70518148 TCACCACGTTGGCCAGGAGATGG + Intronic
1140208236 16:72950684-72950706 GCTGGAAGTTGGCCTTGAGCTGG + Exonic
1141664819 16:85460611-85460633 GCTCCAAGCTGGGCAAGAGCCGG + Intergenic
1143069161 17:4276032-4276054 TCTCCAAGTTGTCCTTGCCCTGG + Intronic
1143863653 17:9908787-9908809 GCTCCATCTTGGCCATTAGCTGG + Intergenic
1145281730 17:21472918-21472940 TCTCCAAGGTGGCCATGCAAAGG - Intergenic
1145395712 17:22492705-22492727 TCTCCAAGGTGGCCATGCAAAGG + Intergenic
1145915962 17:28574163-28574185 TCACCATGTTGGGCTTGAGCAGG + Exonic
1147659411 17:42109368-42109390 TGTCCAAGTTGGCACAGAGCTGG + Exonic
1152124434 17:78437905-78437927 TCTCCTCGTGGGCCAGGAGCTGG - Intronic
1159816591 18:73081587-73081609 TCTCCAAGCAGGGCAGGAGCAGG - Intergenic
1160866075 19:1256602-1256624 TCTCCAGCTCAGCCATGAGCTGG - Intronic
1161814091 19:6488618-6488640 TCACCATGTTGGCCAGGGGCTGG - Intergenic
1162033890 19:7929037-7929059 TTTCCAAGTTGTTTATGAGCTGG + Intronic
1162178376 19:8848538-8848560 TCACCAAGTTGGCCAGGCTCCGG + Intergenic
1162346669 19:10122479-10122501 TCACCATGTTGGCCAGGGGCTGG - Intergenic
1163516036 19:17764416-17764438 TCTCCAAGCTGGCCAGCAACGGG + Exonic
1166160928 19:40952470-40952492 TCTGAGAGTTGGCCATGAGAAGG + Intergenic
1167949643 19:53015893-53015915 TTTCCAAGGAGGCCATCAGCGGG - Exonic
926308919 2:11660349-11660371 TGTCCACTCTGGCCATGAGCAGG + Intronic
929990550 2:46782584-46782606 TCTCCATGATGGTCATGTGCAGG + Intergenic
932073982 2:68646115-68646137 TGGCCAGGTTGGCGATGAGCAGG - Exonic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
933746376 2:85574721-85574743 TCTCCATGTTGGTCAAGAGCTGG + Intronic
935398715 2:102637975-102637997 TCTGCAAAGTGGCCATCAGCTGG - Intronic
936893967 2:117405828-117405850 TCACCATGTTGGCCAAGCGCTGG - Intergenic
937980623 2:127612535-127612557 TCTCCAGGTTGGACATGGGCCGG - Exonic
944250988 2:197580052-197580074 TTGCCAAGTGGGCCATGAACTGG - Intronic
944912504 2:204324165-204324187 TCTTCAAGGTGACCATGAGGAGG + Intergenic
945332046 2:208551209-208551231 TCACCATGTTGGCCAGGAGATGG + Intronic
945468922 2:210204624-210204646 TCTCCAAGTAGGGCACTAGCTGG + Exonic
945675994 2:212856380-212856402 TTTCTCAGTTGGCCATGGGCAGG - Intergenic
946539779 2:220671368-220671390 TCACCATGTTGGCCAGGAGGAGG + Intergenic
946638549 2:221757547-221757569 TTTCCAGGTTGGGCATGGGCAGG - Intergenic
947588295 2:231370440-231370462 TCACAGAGTTGGCCCTGAGCTGG + Intronic
1171107556 20:22449440-22449462 TCTCCAGCTTGGCCCTGAGTAGG + Intergenic
1173035404 20:39404416-39404438 TCTCTGAGTTGGCCATGCACAGG + Intergenic
1173352419 20:42257222-42257244 TCTCCATGTTGGCCTTGACTTGG - Intronic
1178287741 21:31339274-31339296 TCTCCAAATGGGCCATCTGCAGG + Exonic
1178521097 21:33289131-33289153 ACTCCACATTGGCCATGCGCTGG + Intronic
1178710818 21:34914782-34914804 TCTGCAACTTGGCCTTGAGCTGG + Intronic
1180582009 22:16846355-16846377 ACTCCAAGAAGGCCATGAGCCGG + Intergenic
1182133972 22:27883489-27883511 TCTCAAAGGTGGGCATGCGCAGG + Intronic
1183238439 22:36637822-36637844 TCACCATGTTGGCCAGGGGCTGG - Intronic
1184225663 22:43127774-43127796 TCTCCGAGGTGGCCATGCACAGG + Exonic
1184583520 22:45432601-45432623 TCTCTAGGGTGGCCCTGAGCAGG - Intergenic
950006475 3:9694799-9694821 GCTCTGAGTTGGCCATCAGCAGG + Intronic
950403992 3:12793210-12793232 TCACCATGTTGGCCAGAAGCTGG - Intergenic
950497517 3:13342907-13342929 TCTCTAAATTAGCCATGACCTGG - Intronic
955592495 3:60552623-60552645 TTACCAAGTTGGCAATGAACAGG - Intronic
955797316 3:62650984-62651006 TCTCCAAGTTGGCCATGAGCAGG + Exonic
956248953 3:67215419-67215441 TCTCCGTGTTGGCCATGCCCAGG + Intergenic
957155160 3:76536448-76536470 CCACCAAGTGGGCCATGAACTGG + Intronic
957566038 3:81885165-81885187 TGTCCAAGTTGGCAGTGAGTTGG + Intergenic
960007824 3:112798991-112799013 TCTCCAAGTTGGCAAAGTGAAGG + Intronic
960633541 3:119758167-119758189 TCTCAATCTTGGCCCTGAGCTGG - Intronic
967946205 3:194806144-194806166 GCTGCAAGTTGGGCATGATCAGG - Intergenic
968436200 4:590984-591006 GCTCCAAGTTGGCCATGAGGGGG + Intergenic
968773432 4:2523818-2523840 TCTCCATGTTGGTCAAGAGCTGG - Intronic
969101223 4:4769584-4769606 TCTCCCAGGTGGCCAGGAGAGGG - Intergenic
971467829 4:26983414-26983436 TTTCCAACTTGGCCTTCAGCTGG - Intronic
981097002 4:140792314-140792336 TCTGCTAGTTGGCCTTAAGCAGG - Intergenic
986389588 5:7272181-7272203 TCTCCTAGTTTGCCATGAAATGG - Intergenic
986390975 5:7288053-7288075 TCACCATGTTGGCCATGGCCAGG - Intergenic
989626574 5:43435311-43435333 TCACCATGTTGGCCAGGGGCTGG + Intergenic
991150177 5:63358895-63358917 TCCCCAAGTAGCCCTTGAGCAGG - Intergenic
994590064 5:101761002-101761024 TCTGCAAGTAGTCCTTGAGCTGG + Intergenic
998467106 5:142355348-142355370 TCGCCATGTTGGCCAGGAGATGG + Intergenic
998906152 5:146907522-146907544 TCTCCAACTTGGTGATGACCAGG - Intronic
1001481864 5:172094239-172094261 CCTCCCTGTGGGCCATGAGCTGG - Intronic
1003167911 6:3697473-3697495 TCTTTGACTTGGCCATGAGCAGG + Intergenic
1003529275 6:6924611-6924633 TCTCTAAGTGGGTCAGGAGCAGG - Intergenic
1003616926 6:7663322-7663344 TCACCATGTTGGCCAGGGGCTGG - Intergenic
1006852384 6:37108223-37108245 TCACCATGTTGGCCAGGGGCTGG - Intergenic
1007953663 6:45896811-45896833 TCTCCAGGCTGACCAAGAGCTGG - Intergenic
1008565392 6:52762894-52762916 TCTCTATATTGGCCATGAGTTGG + Intronic
1009878283 6:69533397-69533419 TCTGCAAGTTGGACATGACTTGG - Intergenic
1010510591 6:76713768-76713790 TCACCATGTTGGCCATGAATAGG + Intergenic
1010956594 6:82097348-82097370 TCACCATGTTGGCCATTGGCTGG - Intergenic
1011472212 6:87719032-87719054 TCGCCAAGCTGGCCTGGAGCAGG + Intergenic
1013002047 6:106032632-106032654 TCACCATGTTGGCCATGGCCAGG + Intergenic
1013217963 6:108047403-108047425 TCTCCAAGCTGTACATGACCTGG - Intronic
1017096421 6:150809293-150809315 TCTGCACGCTGGCCATGGGCAGG + Intronic
1018503763 6:164442069-164442091 TATCAGAATTGGCCATGAGCTGG - Intergenic
1018571722 6:165218105-165218127 TCTACTAGTTTGACATGAGCTGG + Intergenic
1019927800 7:4204785-4204807 TCTCCCGGCTGTCCATGAGCTGG - Intronic
1021575044 7:22099126-22099148 TCTCCAAGTGGGTCATGGGATGG + Intergenic
1022271859 7:28815765-28815787 TCTCCAAGATGGCCACAGGCAGG + Intronic
1026390581 7:69897540-69897562 TCACCATGTTGGCCAGGAGATGG - Intronic
1028319171 7:89438449-89438471 TCTGCAAGTAGTCCTTGAGCTGG - Intergenic
1029861113 7:103573134-103573156 TTGCCATGTTGGCCAGGAGCTGG + Intronic
1031945439 7:127834887-127834909 TCTCCAGCATGCCCATGAGCTGG - Intronic
1032947483 7:136869990-136870012 TCTCCTCCTTGGCCATGACCTGG - Intronic
1033929951 7:146508684-146508706 TCTGCAAGTAGTCCTTGAGCTGG + Intronic
1036628592 8:10494083-10494105 TGTCCAACTTGGCCATGCTCTGG + Intergenic
1037755181 8:21705837-21705859 TCCCCCAGCTGGCCCTGAGCTGG + Intronic
1041110104 8:54475824-54475846 TGTCTAGGTTGGCCTTGAGCTGG - Intergenic
1041794632 8:61733949-61733971 TCTACTAGTTGGTGATGAGCTGG + Intergenic
1043928478 8:86064432-86064454 TCTCAAAGATCTCCATGAGCTGG + Exonic
1044631706 8:94286541-94286563 TCACCAAGTAGACCATGAGCAGG + Intergenic
1045021204 8:98045763-98045785 TGTCCAGGCTGGCCTTGAGCTGG - Intronic
1047362083 8:124178486-124178508 TCACCATGTTGGCCAGGGGCTGG - Intergenic
1054772932 9:69099954-69099976 TCTCCAAACAGGCCATGTGCTGG + Intronic
1056843393 9:90017298-90017320 TCTCCAAGTTGGCACTGTGGAGG - Intergenic
1056897962 9:90568502-90568524 TCTGCAAATTGAACATGAGCAGG + Intergenic
1058714548 9:107712080-107712102 TCTCCCAGTTGTCCATGATCTGG + Intergenic
1061214038 9:129210029-129210051 TCACCATGTTGGCCAGGGGCTGG + Intergenic
1062433582 9:136536295-136536317 TCTCCAAGTTGCCCTTGGGACGG - Intronic
1190777374 X:53563806-53563828 TCTCCAGGTTGAGAATGAGCTGG - Exonic
1197891301 X:131273240-131273262 TCTCCAAGTTGAGCCTGAGGAGG - Intergenic
1200692671 Y:6322790-6322812 GCTACAAGTTGTCCATGAGATGG + Intergenic
1200712758 Y:6503683-6503705 GCTACAAGTTGCCCATGAGATGG - Intergenic
1201021157 Y:9658358-9658380 ACTACAAGTTGCCCATGAGATGG + Intergenic
1201042602 Y:9851936-9851958 GCTACAAGTTGTCCATGAGATGG - Intergenic