ID: 955797376

View in Genome Browser
Species Human (GRCh38)
Location 3:62651847-62651869
Sequence ACTCCATCAGTTATGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955797376 Original CRISPR ACTCCATCAGTTATGGAATA GGG (reversed) Intronic
901579440 1:10228907-10228929 ACTCCAACATTTATGGTATCGGG + Intronic
909122280 1:71618372-71618394 TCTCCATAAGTTCTGGATTAAGG + Intronic
909660592 1:78077438-78077460 ACTCCATCAGTTATGGAAATAGG + Intronic
912186594 1:107283763-107283785 ACTCCATCTGTTATGCCATAGGG - Intronic
912613228 1:111070043-111070065 ACAGCACCATTTATGGAATAGGG + Intergenic
919036318 1:192313566-192313588 TCTGCATCAGTTATGAAATCCGG + Intergenic
921688467 1:218118987-218119009 ACACCATCACTTTTGGATTAGGG + Intergenic
922641777 1:227239841-227239863 CCTCCCTCAGTTCAGGAATAAGG + Intronic
1063512026 10:6655071-6655093 CCTCCATTATTTAAGGAATAGGG + Intergenic
1068825409 10:61432835-61432857 GCTCCTACAGATATGGAATATGG - Intronic
1073853250 10:107645518-107645540 ACTCCATCATTGATGAAAGATGG - Intergenic
1074516234 10:114173396-114173418 TCTCCATCAGTAATGAAAAATGG - Intronic
1079863620 11:25706893-25706915 CATCCATCAGTTATTGAATGAGG - Intergenic
1081293419 11:41354763-41354785 ATTCCATTATTTATTGAATAGGG - Intronic
1086748159 11:90456033-90456055 ACAGCATCATTTATTGAATAGGG - Intergenic
1087987954 11:104708035-104708057 AATCACTCAGTTATGGAAGAGGG - Intergenic
1089951150 11:122528023-122528045 ACAGCATCATTTATTGAATAAGG + Intergenic
1091893284 12:4080117-4080139 AATGGATCATTTATGGAATATGG - Intergenic
1095156010 12:38855303-38855325 ATTACATCATTTATGTAATATGG - Intronic
1096365547 12:51026121-51026143 ACTCCATCAGTCCTGGACTCTGG + Intronic
1102685558 12:114721852-114721874 TCTCCTTCAGTCATGGAGTATGG + Intergenic
1106145516 13:27046473-27046495 TCTCCAGCAGTGATGGAATCAGG - Intergenic
1110884097 13:80611040-80611062 CCTCCATCAGATCTGGAATGAGG - Intergenic
1111101500 13:83594247-83594269 ACAGCATCATTTATTGAATAGGG + Intergenic
1111454045 13:88456112-88456134 ACTCCAGCTGTTGTGAAATAGGG - Intergenic
1113780966 13:112977127-112977149 ACTCCATTAGTCGTGGAGTAGGG - Intronic
1114746934 14:25158553-25158575 TCTGCACCATTTATGGAATAGGG + Intergenic
1115440108 14:33424693-33424715 AATCCATAAGTTAGGGAATATGG + Intronic
1116181701 14:41543461-41543483 AATCCCTCAGCTCTGGAATATGG - Intergenic
1121078917 14:91091753-91091775 ACTCCATAAGGGATGGAACAGGG - Intronic
1124809372 15:32919326-32919348 TCTTCATCAGTTATGGAAGTGGG + Intronic
1127215236 15:56816905-56816927 ACTTCCTCATCTATGGAATAAGG - Intronic
1128864502 15:71104095-71104117 ATTCCATCTTTTCTGGAATAAGG + Intronic
1130248465 15:82276617-82276639 CCAGCATCATTTATGGAATAGGG - Intronic
1130442956 15:83973789-83973811 ACTCCATCCATTATGGAAGGGGG + Intronic
1130451877 15:84063171-84063193 CCAGCATCATTTATGGAATAGGG + Intergenic
1132079114 15:98850124-98850146 ATTCCCTCAGTGATGGAATTTGG - Intronic
1137899035 16:52245212-52245234 CATCCATCAGTTATTGAATAAGG + Intergenic
1138697882 16:58832658-58832680 ACTCTATCATTCATGGAATTTGG - Intergenic
1140731054 16:77856675-77856697 ACTCCAGCAGCTCTGCAATAAGG + Intronic
1144719665 17:17459863-17459885 ACTCCATAATTTATGGAAGAGGG - Intergenic
1149286362 17:55169344-55169366 GCACCATCAGTTATTGAATGGGG + Intergenic
1153444872 18:5159997-5160019 ATTCCATCAGTAATAGAATTTGG + Intronic
1156238068 18:35223356-35223378 TCTGCATCACTTATTGAATAAGG + Intergenic
1157839960 18:50948089-50948111 AGAGCATCAGTTCTGGAATAAGG - Exonic
1159684394 18:71399938-71399960 AAACTATCATTTATGGAATATGG + Intergenic
1165951360 19:39475546-39475568 TCTCCATCAGTGATGGATTGGGG + Intronic
924966683 2:83057-83079 ACAACATCAGTCATGGAATAAGG - Intergenic
927839902 2:26434119-26434141 ACTCTATCAGTTCTAAAATATGG + Intronic
928357895 2:30637394-30637416 AGTCTATCAGCAATGGAATAGGG + Intronic
928534485 2:32226937-32226959 ACTCTATTAACTATGGAATAAGG - Intronic
930679726 2:54243859-54243881 TTTCCATCAGTGATGGACTATGG - Intronic
930844712 2:55889882-55889904 ACTCCATCAATTTAGGAAGAAGG + Intronic
937805314 2:126135263-126135285 AGTCAATCCGTTTTGGAATATGG + Intergenic
940140933 2:150489695-150489717 ACTACATCAATTCTGAAATATGG - Intronic
942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG + Intergenic
942719603 2:178936329-178936351 ATTCCAGCATTTATTGAATAGGG + Intronic
943921857 2:193717537-193717559 ACTTCTTCATTTGTGGAATATGG - Intergenic
945840353 2:214880347-214880369 ACTCCTAGAGTTATAGAATAAGG + Intergenic
948539863 2:238683044-238683066 ATTCAATAAGCTATGGAATAAGG - Intergenic
1172969460 20:38862819-38862841 ATTCCATCAGTTATGGCCTTTGG + Intronic
1176694173 21:9953933-9953955 CCTGCATCATTTATTGAATAGGG + Intergenic
949376032 3:3391542-3391564 GCTCCATCAGGAATAGAATAGGG - Intergenic
950157426 3:10733169-10733191 CATCCATCAGCTATGGAACAAGG + Intergenic
951709745 3:25576048-25576070 TCTTCCTCAGTGATGGAATAAGG + Intronic
953446220 3:42970082-42970104 ACTCCATCACTTATGGACTTGGG - Intronic
955797376 3:62651847-62651869 ACTCCATCAGTTATGGAATAGGG - Intronic
957862670 3:85976208-85976230 ACTCCATCAAATATGGTACAGGG - Intronic
958921907 3:100116519-100116541 CCTCCATCCATTATGGAAAATGG + Intronic
959315922 3:104806621-104806643 TATACATCATTTATGGAATAAGG + Intergenic
960302902 3:116026167-116026189 ACTCCCTCAGCTATGCAATGGGG + Intronic
962555244 3:136543616-136543638 GCTCCATCAGTTACCGGATATGG + Intronic
963632268 3:147747945-147747967 ACAGCATCATTTATTGAATAGGG + Intergenic
964545851 3:157832499-157832521 AGTCCTTCAGTTAATGAATATGG + Intergenic
970247469 4:14078400-14078422 GCTACATCAGTTTTGGAATGTGG + Intergenic
972085540 4:35209761-35209783 AGTCCTTCAGTTTTGGAATTTGG + Intergenic
974210609 4:58769588-58769610 GTTCCATCAGTGATGGATTAGGG - Intergenic
974955372 4:68633546-68633568 CCACCATCATTTATTGAATAGGG + Intronic
975159951 4:71113668-71113690 ACTCCATAAGTTATGGGACATGG - Intergenic
979558802 4:122079227-122079249 ATAACATCAGTTATGGAATAAGG + Intergenic
980366796 4:131814131-131814153 CCTGCATCATTTATTGAATAGGG + Intergenic
984059957 4:174979395-174979417 ACTCCTTCAGTTTTGGAACTCGG - Intergenic
986041971 5:4002301-4002323 ACCCAATCAATAATGGAATAGGG + Intergenic
986620809 5:9672048-9672070 CCACCATCATTTATTGAATAGGG - Intronic
987622213 5:20349118-20349140 ATTCCTTTAGTTATGGAACAAGG - Intronic
993571650 5:89547496-89547518 ACTGCATCTGTTATGCAATATGG + Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995778516 5:115751232-115751254 GCTCCATCCGGTATGGAATCAGG + Intergenic
996946538 5:129077152-129077174 ACTCCATAAATTTTGGACTAAGG - Intergenic
997754822 5:136386514-136386536 AGTCCATTAGTCATGGGATAGGG - Intronic
997790069 5:136750936-136750958 TTTCCATCTGTTATTGAATAAGG + Intergenic
1000179527 5:158794501-158794523 ACTCCATTGAATATGGAATAAGG - Intronic
1003111738 6:3256794-3256816 CCTCCATCAGTTATTGTATGTGG + Intronic
1005130304 6:22499101-22499123 AATCCATCATTTGTGGAGTAGGG - Intergenic
1006624980 6:35391381-35391403 AATCCAACAGATATGGAATGTGG - Intronic
1009721281 6:67473535-67473557 AGTCTATGATTTATGGAATAAGG - Intergenic
1010560902 6:77348856-77348878 ACTGCATCATTTATGTAAAATGG + Intergenic
1011120753 6:83949617-83949639 ACTCCATCCTTTGTGGAACAAGG + Intronic
1011886638 6:92104702-92104724 ACACCACCATTTATTGAATAGGG + Intergenic
1012678409 6:102146889-102146911 ACAGCATCACTTATTGAATAGGG - Intergenic
1012896986 6:104960338-104960360 TGTGCATCACTTATGGAATAAGG + Intronic
1018424185 6:163665010-163665032 ACTCCATCAGTTAATCAACAGGG + Intergenic
1019369002 7:651083-651105 ACTCCTTCAGGTCTGGAATTTGG + Intronic
1020648074 7:10840585-10840607 CCACCATGAGTTATGGAATAAGG + Intergenic
1021456282 7:20832440-20832462 AGTCCATGAGATATGGTATATGG + Intergenic
1025778098 7:64576485-64576507 ACTAAATCAGTTATTGAATTTGG - Intergenic
1033390009 7:140918192-140918214 ACTTCAATAGTTATGGTATAGGG + Intronic
1036544593 8:9754912-9754934 ACACCTTCAGTTAGGGAATAAGG - Intronic
1036593105 8:10186574-10186596 ACTCAATTAGTTATAGAACAGGG - Intronic
1038253474 8:25928005-25928027 AGTCCATCAGATAAGGAACACGG + Intronic
1040806401 8:51401673-51401695 ACTACATCAGTGAAGGAATAGGG + Intronic
1042242662 8:66680314-66680336 TCTCCATCAGGTATGGATTTGGG + Exonic
1043130249 8:76450683-76450705 AATCCATCTGTTTTGGAAAATGG - Intergenic
1044444290 8:92256213-92256235 AATCCATGAGCTATGGAATAGGG + Intergenic
1048253131 8:132883781-132883803 ACTCCATCAGCTCTGGAACATGG - Intronic
1048707043 8:137165346-137165368 ACTCCATCAGTCATTAAATATGG - Intergenic
1049293032 8:141813920-141813942 CCTCCAGCAGTTCTGGAAAAGGG + Intergenic
1049879793 8:145053750-145053772 ACTCAAACTGTTATGGGATATGG - Intronic
1050695970 9:8279447-8279469 ACTCGATCAGTTCTGGGACAAGG - Intergenic
1051156539 9:14153802-14153824 ACTTCATTATTTATGAAATAGGG - Intronic
1051751426 9:20346036-20346058 AATAGATCAGTTATGTAATAAGG + Exonic
1052102526 9:24466469-24466491 ATTACATCATTTTTGGAATAGGG + Intergenic
1053631150 9:39940034-39940056 CCTGCATCATTTATTGAATAGGG + Intergenic
1053774619 9:41523471-41523493 CCTGCATCATTTATTGAATAGGG - Intergenic
1054212737 9:62310664-62310686 CCTGCATCATTTATTGAATAGGG - Intergenic
1055466704 9:76573839-76573861 ACTCCAACAGTTAAGAAATCTGG + Intergenic
1056107854 9:83364925-83364947 AATCCATTATTTATAGAATATGG - Intronic
1058597067 9:106626583-106626605 ACTCCATAAACCATGGAATAAGG - Intergenic
1059370180 9:113824365-113824387 ACTCCAACTGTTATGGTATTAGG + Intergenic
1186667065 X:11728083-11728105 CCAGCATCATTTATGGAATATGG + Intergenic
1188756252 X:33968201-33968223 ACTCCATCACTGATGGTAGATGG + Intergenic
1188806210 X:34593557-34593579 ACTTGATAAGTTAGGGAATATGG + Intergenic
1189653516 X:43215986-43216008 CCAGCATCAGTTATTGAATAGGG - Intergenic
1191891189 X:65943410-65943432 ACTGCACCATTTATTGAATAGGG + Intergenic
1192627697 X:72747235-72747257 CCACCATCATTTATTGAATAGGG + Intergenic
1192654011 X:72973577-72973599 CCACCATCATTTATTGAATAGGG - Intergenic
1193304964 X:79938054-79938076 ACAGCATCATTTATCGAATAGGG + Intergenic
1193434755 X:81459290-81459312 CCTGCATCATTTATTGAATAGGG + Intergenic
1194242779 X:91471874-91471896 ACTCAATCAGATATGGAAGACGG + Intergenic
1194374936 X:93120829-93120851 GCTCCATCAAGTATGGAATCAGG + Intergenic
1194976693 X:100403353-100403375 ACTCGATCAGTTTTGGACTGGGG + Intronic
1195534530 X:105996375-105996397 ACTGCACCATTTATTGAATAGGG - Intergenic
1196238527 X:113311544-113311566 ATCCCATCATTTATTGAATAAGG - Intergenic
1196854766 X:119972454-119972476 ACCCCGTCAGTTATGGGAAAGGG + Intergenic
1196857172 X:119995197-119995219 ACTCCATCACTTATGGGAAATGG + Intergenic