ID: 955798207

View in Genome Browser
Species Human (GRCh38)
Location 3:62659758-62659780
Sequence TGAGCTCTTCTTCACCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955798207_955798216 16 Left 955798207 3:62659758-62659780 CCACCTGGGTGAAGAAGAGCTCA 0: 1
1: 0
2: 2
3: 23
4: 162
Right 955798216 3:62659797-62659819 CTATATAGCAAGGGGGCCACTGG 0: 1
1: 0
2: 0
3: 5
4: 58
955798207_955798214 8 Left 955798207 3:62659758-62659780 CCACCTGGGTGAAGAAGAGCTCA 0: 1
1: 0
2: 2
3: 23
4: 162
Right 955798214 3:62659789-62659811 CCAGTTAGCTATATAGCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 64
955798207_955798212 7 Left 955798207 3:62659758-62659780 CCACCTGGGTGAAGAAGAGCTCA 0: 1
1: 0
2: 2
3: 23
4: 162
Right 955798212 3:62659788-62659810 ACCAGTTAGCTATATAGCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 81
955798207_955798211 6 Left 955798207 3:62659758-62659780 CCACCTGGGTGAAGAAGAGCTCA 0: 1
1: 0
2: 2
3: 23
4: 162
Right 955798211 3:62659787-62659809 GACCAGTTAGCTATATAGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 54
955798207_955798215 9 Left 955798207 3:62659758-62659780 CCACCTGGGTGAAGAAGAGCTCA 0: 1
1: 0
2: 2
3: 23
4: 162
Right 955798215 3:62659790-62659812 CAGTTAGCTATATAGCAAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955798207 Original CRISPR TGAGCTCTTCTTCACCCAGG TGG (reversed) Intronic
908745675 1:67374361-67374383 TGATCTCTTCTTCAGCCATCTGG + Intronic
912584579 1:110750725-110750747 TGAGCTGTTTTTCATCCTGGTGG + Intergenic
915194075 1:154176191-154176213 CCAGCTCTTCTTCAACCAGCTGG + Exonic
915758778 1:158290089-158290111 CTAGCTCTTCTTCTCCCAGGTGG + Exonic
918251700 1:182708734-182708756 TGAGCTCTGATTCCCCCATGCGG - Intergenic
921259142 1:213370093-213370115 TGAGCTTTTCTTGGCCCTGGAGG - Intergenic
922277841 1:224095793-224095815 TAAGTTCTTCTTCACACAGCAGG + Intergenic
923874249 1:238030212-238030234 TGATCTCTTTTTCACCCAAGGGG - Intergenic
924037332 1:239950564-239950586 TGAGCTCTGCTTCTCCCAGCAGG + Intergenic
1064143726 10:12810947-12810969 TGAGCACCTCTAGACCCAGGGGG + Intronic
1064151552 10:12869870-12869892 TGAGCTCTTCTTGACCATGCAGG - Intergenic
1065793185 10:29280507-29280529 TGAGCTCCTCCTCACACAGGAGG - Intergenic
1069757586 10:70782589-70782611 TCAGCTCTTCCTCTCCTAGGAGG - Intronic
1071712501 10:88063302-88063324 TGAAAGCTTCTTCACCCAGAGGG - Intergenic
1071760427 10:88598684-88598706 TGTGCACTTCTTCATCCAGAAGG + Intronic
1072759148 10:98041563-98041585 TGAGCTTGTTTTCACCCAGTAGG - Intergenic
1075969301 10:126638948-126638970 TGGCCTCCTCTTCACCCTGGTGG - Intronic
1076749094 10:132533303-132533325 AAAGCTCTTGTTCTCCCAGGAGG - Intergenic
1081018979 11:37919564-37919586 TGAATTCCTCTTCCCCCAGGAGG + Intergenic
1082952974 11:58837762-58837784 TGAGCTAATCCTGACCCAGGGGG + Intronic
1083367101 11:62147976-62147998 TCAGCTCCACTTCACACAGGGGG + Intronic
1083682234 11:64356997-64357019 TGAGATCTGCTTCCCTCAGGAGG - Intronic
1084284938 11:68124979-68125001 TTAGCACTTCATCTCCCAGGTGG + Intergenic
1084662393 11:70553826-70553848 TGGGCTCTTATTCACTGAGGGGG - Intronic
1084956737 11:72695610-72695632 TGAGCTCTTCCTCATCCACCTGG + Exonic
1085029019 11:73258468-73258490 TGAGCTCTGGTTCTCCCAGCTGG - Intergenic
1085126748 11:74007192-74007214 GGAACTCTTCCTTACCCAGGAGG + Intronic
1087070286 11:94073031-94073053 TGATCTCTACTTCACACAAGGGG + Exonic
1087241686 11:95789023-95789045 TGTCCTCTTCTTCCACCAGGAGG - Intronic
1087563361 11:99819673-99819695 TGAGTGCTTCTTCACCCAGCTGG + Exonic
1090306232 11:125693513-125693535 GGAGCTCTTCCTCAGGCAGGTGG - Intergenic
1090665341 11:128911498-128911520 TGACCTCTTCACCACCCTGGTGG + Exonic
1095681548 12:44982056-44982078 TGAGCTCTTCTTGACCTACAAGG + Intergenic
1101754428 12:107609827-107609849 TGACCTCTCTTTCACCCATGGGG - Intronic
1102828645 12:115973627-115973649 TGAGCTATTCTTAACCCTTGGGG - Intronic
1103313906 12:120035804-120035826 CGACCTCTTCTTCCCCCAAGAGG + Intronic
1104330800 12:127842913-127842935 TGACCACTTCAGCACCCAGGAGG + Intergenic
1107730078 13:43339762-43339784 TCAGCTTTCCTTCTCCCAGGTGG - Intronic
1108072202 13:46639781-46639803 TGGGCTCTTCTGCACCCTTGGGG + Intronic
1108506973 13:51121047-51121069 TGACCTCTTCTGCCCCCTGGTGG + Intergenic
1108582594 13:51839624-51839646 TAAGCCCTAGTTCACCCAGGAGG - Intergenic
1112496556 13:99910341-99910363 GGAGGTCTTATTTACCCAGGAGG - Intergenic
1113145484 13:107203341-107203363 TGATCTCCTCTACAGCCAGGAGG - Intronic
1113427604 13:110222252-110222274 TGAGTACTTCTTCAACAAGGGGG - Intronic
1118821583 14:69349465-69349487 TGTGCCCCTCTTCTCCCAGGAGG + Intronic
1119073694 14:71614126-71614148 TGAACTCCTTTTAACCCAGGAGG + Intronic
1119241229 14:73061594-73061616 TGGGGTCTCTTTCACCCAGGTGG + Intronic
1120925569 14:89793960-89793982 TCAACTCTGGTTCACCCAGGGGG - Intergenic
1120958708 14:90105342-90105364 TGAGGACTACTTCACCAAGGGGG - Intronic
1121809050 14:96863435-96863457 TAAGCTGTTCTTAACCCAGATGG - Intronic
1122526050 14:102385269-102385291 TGAGCACTCATTCACCCATGAGG + Intronic
1124172595 15:27388824-27388846 TTAGCTCTTCTTCTTCCATGGGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1127842184 15:62841130-62841152 TGAGCACTGGCTCACCCAGGGGG + Exonic
1128156422 15:65394571-65394593 TGAGCTCTGCTCCACCGACGTGG + Intronic
1131525598 15:93150150-93150172 TGAGCTCCTTGGCACCCAGGAGG + Intergenic
1134504058 16:14791052-14791074 CCACCTGTTCTTCACCCAGGTGG + Intronic
1134576514 16:15337856-15337878 CCACCTGTTCTTCACCCAGGTGG - Intergenic
1134725929 16:16418643-16418665 CCACCTGTTCTTCACCCAGGTGG + Intergenic
1134941505 16:18293216-18293238 CCACCTGTTCTTCACCCAGGTGG - Intergenic
1136396060 16:29993187-29993209 TGAGCTCTGCCACCCCCAGGAGG - Exonic
1137938165 16:52655471-52655493 CCAGCTCTTCTTCAACCAGCTGG - Intergenic
1141594855 16:85091010-85091032 AGAGCTCTCCTACACCCAGGTGG - Exonic
1141649339 16:85384866-85384888 TGGGCTTTTCTGCACCCTGGGGG + Intergenic
1144841002 17:18185603-18185625 TGGGCTCTTCTGCAGCCAGGAGG - Intronic
1146370323 17:32262094-32262116 TGACCTCATTTTCCCCCAGGAGG + Intergenic
1146548000 17:33755799-33755821 TGATGCCTTCTTCACCCAGTGGG - Intronic
1147570577 17:41568024-41568046 TGAGGACTTCTTCATCCTGGGGG - Intronic
1147661254 17:42118221-42118243 TGAGCTCTCTTCCACCCAGGAGG + Intronic
1150281708 17:63932729-63932751 TGAACTATTCCTCACCCAGCGGG + Intergenic
1150308258 17:64105142-64105164 TGAGGTCTTTGTCACCCAGGTGG + Intronic
1152216147 17:79033833-79033855 TGCCCTCTTCTTCAGCCATGGGG - Intronic
1155597169 18:27501812-27501834 TGCGCTCTTCTTCTCCCCAGTGG - Intergenic
1156907238 18:42368571-42368593 AGGGCTCTTCTTGACCCATGTGG + Intergenic
1157602573 18:48902968-48902990 TGGTGTCTTCTCCACCCAGGTGG - Intergenic
1160317652 18:77862592-77862614 TGAGCTCTTCTCCAGACAGGTGG + Intergenic
1160564120 18:79776451-79776473 TGCTCTCTTCTTCACTAAGGGGG - Intergenic
1161579574 19:5073415-5073437 GGAGCTGGGCTTCACCCAGGCGG + Intronic
1161768771 19:6220412-6220434 GGCGCTCTTCTTCGGCCAGGAGG + Intronic
1162799144 19:13101432-13101454 TGAGCTCTTTGTGACCCAGGAGG + Intronic
1164563126 19:29307852-29307874 TGAGCTCTGCTTCAGCCAAATGG - Intergenic
1164898263 19:31896407-31896429 AGACCTCTTCTCCAACCAGGAGG + Intergenic
1165371257 19:35407827-35407849 GGAGCTCTTCTTCACCCCCATGG + Intergenic
1166008698 19:39925506-39925528 TTAGCTCTTTTTGACCCTGGAGG - Intronic
1167497622 19:49828784-49828806 TGTGCTCTACGTCACCCAGCAGG - Intronic
1167498932 19:49834967-49834989 AGAGCTGTTGTCCACCCAGGCGG + Exonic
1167854628 19:52227577-52227599 TGAGCACATTTTGACCCAGGTGG + Exonic
926010297 2:9401333-9401355 TGAGCTCACCTTCTCCGAGGGGG + Exonic
933610155 2:84425533-84425555 TGACCCATTCTTCTCCCAGGAGG + Exonic
936224782 2:110638725-110638747 CCAGCTCTTCTTCACACTGGTGG + Intronic
936854208 2:116937073-116937095 TGAGCTCTCCCACTCCCAGGTGG - Intergenic
938199831 2:129363502-129363524 TGAGCTCTTTCTGAGCCAGGTGG - Intergenic
939708477 2:145484588-145484610 TGATCTCTTCTGCCCCCAGATGG + Intergenic
943075938 2:183195194-183195216 TGAGCTTTTCCTCTCCCAAGAGG + Intergenic
946022486 2:216650610-216650632 TGAGCTCTTCCGCACTCAGCTGG + Intronic
947358117 2:229318065-229318087 TGGCCTTTTCTTCATCCAGGTGG + Intergenic
947488456 2:230573722-230573744 CCAGCTCTTCTTCAACCAGCTGG + Intergenic
948608412 2:239151379-239151401 TGTGCTCTTCCTCACCAAGCGGG + Intronic
1173310168 20:41890213-41890235 CGAGCTCTGCTTCTCCCAGAGGG - Intergenic
1174074446 20:47922998-47923020 TGATTTCTTCTTCACCCAGGAGG - Intergenic
1178347909 21:31847905-31847927 TGAGCTCTTCAGCTCCCGGGGGG - Intergenic
1178374352 21:32054745-32054767 TGCTCTGTTCTTCACCCAAGTGG + Intergenic
1178582783 21:33850340-33850362 TGAGCTCTGCTGGACCCACGAGG + Intronic
1179892597 21:44344469-44344491 TGAGCTCTTCTACACCAAGCAGG + Intergenic
1180921527 22:19523955-19523977 TGCGCTCTTCGTGACCCTGGCGG - Exonic
1181869557 22:25886994-25887016 TGAGCTGTTTCTCACCCAAGGGG + Intronic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
1184471053 22:44696596-44696618 TGAGCCCTTCTCCACCCTGGTGG - Intronic
951532503 3:23710933-23710955 TGAGCTCTTCTTCAGCCTGCAGG + Intergenic
953111519 3:39945061-39945083 TGAGCCCTGTTTCACCCAAGAGG + Intronic
954132132 3:48566312-48566334 TGTGGTCTTCTGCTCCCAGGAGG - Exonic
954403262 3:50330561-50330583 TGACCTCTTGTACCCCCAGGTGG - Exonic
955421463 3:58742558-58742580 TGAGGTCTTCTTCACCTGTGGGG + Exonic
955798207 3:62659758-62659780 TGAGCTCTTCTTCACCCAGGTGG - Intronic
955864094 3:63363684-63363706 TGAGCTGTTCTTTACTCATGTGG + Intronic
958100237 3:88999462-88999484 TGAGCTCTTGTTCACCATTGAGG - Intergenic
962026920 3:131557427-131557449 TGAGCTCTTAATCAGTCAGGTGG - Intronic
964590885 3:158361047-158361069 GGAGCTCCTCCTCACCCATGTGG + Intronic
964874491 3:161350802-161350824 TAAGCCCTGCTTCAGCCAGGTGG + Intronic
965643232 3:170853826-170853848 TGAGTTCTTGTTCACCTAAGAGG - Intronic
967188027 3:186961901-186961923 TTTGCTCTTGTTCCCCCAGGAGG + Intronic
970224153 4:13839731-13839753 TTAGCTGTTCTTCACCCAAGTGG - Intergenic
971734495 4:30428839-30428861 TGTGCTCATCTTCACACTGGAGG - Intergenic
972680189 4:41298890-41298912 TGTGCTCTTCCTCACCCATAAGG + Intergenic
972760982 4:42103859-42103881 TGAGCTTTTCTTGAGCCAGCAGG + Intergenic
973039307 4:45450869-45450891 TGAGCTATTCTCCACACAGAAGG - Intergenic
975801051 4:78059059-78059081 TGAACTCTTCTTCCCGCAGCTGG - Intronic
976711814 4:88080429-88080451 TGAGCTCTACTGCATCCAGAGGG + Intergenic
979931767 4:126640801-126640823 GGAGCCCTGCTTCTCCCAGGAGG - Intergenic
982752628 4:159180200-159180222 TAAGCTTTTCTTCAATCAGGAGG - Intronic
986081627 5:4400570-4400592 TAAGCTCTTCTCCACCTAGGAGG - Intergenic
986175747 5:5350392-5350414 TGAGCTCCTCTCTTCCCAGGGGG + Intergenic
986765341 5:10920926-10920948 GGAGCTCTTCTTGACCAGGGAGG + Intergenic
988520908 5:31944904-31944926 TGCCCTCTTCTGCACCCAGCAGG - Intronic
990023507 5:51158150-51158172 TGAGCTCTTCTTTCAACAGGAGG + Intergenic
991504595 5:67311035-67311057 TGAGCTGTACTTCACCGGGGAGG + Intergenic
993643616 5:90436074-90436096 TGGCCTCTTCTTCACCCAGGGGG - Intergenic
995534858 5:113124931-113124953 TGAGCGCTGCTCCACCCAGGAGG - Intronic
1000073114 5:157759708-157759730 TGTGCTTTTCTTCTCCCAGAAGG + Exonic
1001024236 5:168209970-168209992 TTAGCTCTTCTTCACACTGCAGG - Intronic
1001407674 5:171487319-171487341 AAAGCCCTTCTTCCCCCAGGAGG - Intergenic
1001602152 5:172935918-172935940 GGTGCCCTTCTTCACCCAAGAGG + Intronic
1004873388 6:19930386-19930408 TGAAGGATTCTTCACCCAGGAGG + Intergenic
1007213854 6:40220640-40220662 TAACCTCTTCTTCATTCAGGTGG - Intergenic
1007512138 6:42381761-42381783 TGGGCTCTGCTTCTCCCAGGAGG - Intronic
1008111728 6:47502365-47502387 GGAGCACTGCTTGACCCAGGAGG - Intronic
1008192442 6:48476041-48476063 TGAGCTCCCCCACACCCAGGTGG - Intergenic
1009482104 6:64171943-64171965 TGAGCCTTTCTTCAGGCAGGAGG + Intronic
1013200935 6:107895301-107895323 TCAGTTCCTCTTCTCCCAGGAGG + Intronic
1016140333 6:140600785-140600807 TGAGCTCTTTTTTACCCTGGGGG + Intergenic
1016982584 6:149866377-149866399 TGACATCTGCTTCAGCCAGGAGG + Intergenic
1018711493 6:166500899-166500921 TGTGCCCCTCTTCATCCAGGAGG + Exonic
1019134029 6:169897151-169897173 TGTCCTCTTGTTCTCCCAGGCGG + Intergenic
1019430737 7:997774-997796 TGAGCACTTCTCCACCCTGCTGG - Exonic
1019603675 7:1897966-1897988 TAGGGTCTTCTGCACCCAGGAGG + Intronic
1020289110 7:6709002-6709024 AGAGCTCTTCTCCTCCCAGTGGG - Intergenic
1023039219 7:36157567-36157589 TGATCCCTTCTACACCCTGGTGG - Intronic
1024574427 7:50752655-50752677 TGGGCTCTTACTCACACAGGAGG - Intronic
1029158079 7:98531571-98531593 TGGGGTCTTCTTCGCCCAGAGGG + Intergenic
1031522891 7:122788010-122788032 TGTGCTCTTATTCTCACAGGGGG - Intronic
1031905896 7:127459130-127459152 TGAGTTCTTCTTGGCCCTGGGGG - Intergenic
1032239177 7:130148021-130148043 TGGGCTCTTCTTCCCCAAGAGGG - Intergenic
1032256337 7:130300010-130300032 TGCTCTCTCCTTCACCGAGGTGG + Intronic
1033425993 7:141244806-141244828 TGAGTTCTTCTTCCCCCCGAGGG - Intronic
1036678493 8:10853593-10853615 TGATCTCCTCTGCACCCAGGTGG - Intergenic
1036767028 8:11555799-11555821 TTAGCTTTTCATCACCCAGATGG + Intronic
1040770217 8:50965573-50965595 TGACCTCTTCTTCTCCAAAGAGG - Intergenic
1043375914 8:79649294-79649316 GGTGCTCTTCTTCACCGAGAAGG - Intronic
1048440286 8:134454592-134454614 TGAGCTCTTTGTCACTCAGGGGG + Intergenic
1049432546 8:142571957-142571979 TGAGCTGCTCTACACCCAGGAGG - Intergenic
1050607208 9:7314522-7314544 TGGGCCCATCTTCACCCTGGAGG + Intergenic
1051918234 9:22232848-22232870 TGAGCTCTTCTTTTCACACGTGG - Intergenic
1053863644 9:42413269-42413291 TGACCTCTTCTTTTCCCATGCGG + Intergenic
1054812135 9:69443319-69443341 TGACCTCATCTGCATCCAGGTGG + Intronic
1055162267 9:73144631-73144653 TGACTTCTTGTTCACCCAGATGG + Intergenic
1055610609 9:78020526-78020548 TGTGCCCTTCCTCACCCAGATGG - Intronic
1057222006 9:93262522-93262544 TGCTCTCTTCTGCAGCCAGGTGG - Intronic
1057294736 9:93828364-93828386 AGGGCTCTTTTCCACCCAGGGGG + Intergenic
1057798744 9:98176416-98176438 TGAGCACATCTTCCCCCAGCAGG - Intronic
1058671889 9:107366991-107367013 TGGGTGCTCCTTCACCCAGGTGG - Intergenic
1059726362 9:117012293-117012315 TGAGCTCTTATTCACCCAATGGG + Intronic
1060735012 9:126061348-126061370 TGGGCTGTTCTCCAGCCAGGAGG + Intergenic
1186487795 X:9946874-9946896 TCAGCTGCTCTTCACCAAGGTGG - Exonic
1188013617 X:25083955-25083977 TGAGCTCTTCACCAGGCAGGAGG + Intergenic
1193148210 X:78099332-78099354 TGATCTCTTCTTCACACATATGG - Intronic
1195050780 X:101094752-101094774 TGTGCTCTTCTTCCACCAGCTGG + Exonic
1197081430 X:122422693-122422715 TGAGTTCCTCTTCACCCATTTGG + Intergenic
1200083447 X:153591125-153591147 TGAGCTCTGCAGCACCCGGGTGG + Intronic