ID: 955801813

View in Genome Browser
Species Human (GRCh38)
Location 3:62694531-62694553
Sequence GATTTCTGTCCCTTCTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955801813_955801814 -1 Left 955801813 3:62694531-62694553 CCATCATAGAAGGGACAGAAATC 0: 1
1: 0
2: 1
3: 9
4: 235
Right 955801814 3:62694553-62694575 CAGTCCTCATTGTAATATTCTGG 0: 1
1: 0
2: 0
3: 10
4: 114
955801813_955801816 19 Left 955801813 3:62694531-62694553 CCATCATAGAAGGGACAGAAATC 0: 1
1: 0
2: 1
3: 9
4: 235
Right 955801816 3:62694573-62694595 TGGAAATGAATTTGCCTTCTTGG 0: 1
1: 0
2: 3
3: 39
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955801813 Original CRISPR GATTTCTGTCCCTTCTATGA TGG (reversed) Intronic