ID: 955801813

View in Genome Browser
Species Human (GRCh38)
Location 3:62694531-62694553
Sequence GATTTCTGTCCCTTCTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955801813_955801816 19 Left 955801813 3:62694531-62694553 CCATCATAGAAGGGACAGAAATC 0: 1
1: 0
2: 1
3: 9
4: 235
Right 955801816 3:62694573-62694595 TGGAAATGAATTTGCCTTCTTGG 0: 1
1: 0
2: 3
3: 39
4: 306
955801813_955801814 -1 Left 955801813 3:62694531-62694553 CCATCATAGAAGGGACAGAAATC 0: 1
1: 0
2: 1
3: 9
4: 235
Right 955801814 3:62694553-62694575 CAGTCCTCATTGTAATATTCTGG 0: 1
1: 0
2: 0
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955801813 Original CRISPR GATTTCTGTCCCTTCTATGA TGG (reversed) Intronic
903117485 1:21190150-21190172 GATTTCTCTCATCTCTATGAAGG + Intergenic
905176613 1:36140035-36140057 CATTTCTGTCTCTCCTATGAAGG + Intronic
905211928 1:36380421-36380443 GCTTTCTCTCCCTTCCCTGAAGG + Intronic
905840346 1:41171237-41171259 AAATGCTGTCCCTTCCATGAAGG - Intronic
906085004 1:43124940-43124962 TATTACTGTCCCATGTATGAAGG + Intergenic
906963775 1:50436598-50436620 GCTCTCTGACCCTTCTCTGATGG + Intergenic
907660759 1:56390539-56390561 GATTTCTGGGCCTTTAATGAGGG - Intergenic
908340746 1:63176232-63176254 GATTCTTTTCCATTCTATGAAGG - Intergenic
908679528 1:66644902-66644924 GTTTTCTTTTCCTTCTATAATGG + Intronic
908693548 1:66810482-66810504 GTTTTCTTTTCCTTCTGTGATGG + Intergenic
908728858 1:67205647-67205669 AATTTCAGTTCCTTCTGTGAAGG + Intronic
910496725 1:87837949-87837971 AATTTCTGTCCATTGTTTGATGG + Intergenic
911121495 1:94301585-94301607 GCTTTCTGCCCCTTGTATGGTGG + Intergenic
912873978 1:113336976-113336998 ACTTTCTTTCCATTCTATGAAGG - Intergenic
917285751 1:173419769-173419791 GCTTTATGTCCCTGCTATAATGG + Intergenic
917473806 1:175350899-175350921 GTTTTCTATGCCTTCTCTGATGG - Intronic
919956664 1:202424139-202424161 GATTGCTGACTCTTCAATGAGGG + Intronic
920140236 1:203805516-203805538 CGTTTCTGTCCTTTCTTTGAAGG - Intronic
921450053 1:215294871-215294893 CATTTCTGTCCCATCTAAGGTGG + Intergenic
1064955292 10:20901696-20901718 GATTTGTTTCCCTGCCATGATGG + Intronic
1066808006 10:39283249-39283271 TATTTCTGCCCATTCTGTGAAGG - Intergenic
1067228585 10:44391186-44391208 GATCTCTGTCCCTTATTTCAGGG - Intergenic
1068021420 10:51590099-51590121 GATTTTTTTCTCTTCAATGATGG + Intronic
1068646867 10:59477895-59477917 GCCTTCAGTCCCATCTATGAGGG - Intergenic
1069519966 10:69111129-69111151 AATCTCTGGCCCTTCCATGATGG - Intergenic
1071036307 10:81250516-81250538 GATTTTCTTCACTTCTATGAGGG - Intergenic
1071473762 10:86007192-86007214 GTCTTCTTTCCCTTTTATGATGG - Intronic
1072060162 10:91801992-91802014 TATTTCTTTCATTTCTATGATGG - Intronic
1074471556 10:113731737-113731759 CATTTCTTTCCCTTTAATGAAGG - Intergenic
1075632382 10:124008585-124008607 GCTGTGTGTCCCTTCTCTGATGG + Exonic
1079759703 11:24313137-24313159 AATTTATGTCACTTCTATAACGG + Intergenic
1080113933 11:28600924-28600946 AATTTCTGTCCCTTTTGTTAAGG - Intergenic
1080588837 11:33703989-33704011 GCTTTCTGTGCTTTCTCTGAAGG - Intronic
1082298745 11:50478022-50478044 TGTTTTTGTCCATTCTATGAAGG - Intergenic
1084338715 11:68477829-68477851 AGGTTCTGTACCTTCTATGATGG + Intronic
1086399862 11:86451658-86451680 GATTTCTTTCCTGTCCATGATGG - Intronic
1087374164 11:97321579-97321601 AATCTCTGTCCTTTCCATGATGG - Intergenic
1088093861 11:106076456-106076478 GATTTCTGTCCTATTTAAGATGG - Intronic
1088207167 11:107405658-107405680 CATTTCTTTCCCTTCTTTTAGGG - Intronic
1088264136 11:107973716-107973738 GATCTCTGCCCCTTCCATGATGG + Intergenic
1088384439 11:109237691-109237713 GATTTCTGACCCTTCTCTTTAGG + Intergenic
1088780290 11:113127765-113127787 TATTTCTGTCTCTTGTAGGAAGG - Intronic
1089255803 11:117193347-117193369 GTTTTCTGTCCCATCTTTGCTGG + Intronic
1089837389 11:121383193-121383215 AATTTCTCTTCCCTCTATGAAGG + Intergenic
1089901446 11:121989985-121990007 GATTTCAGTTCCTTCCAAGAAGG - Intergenic
1090457708 11:126864279-126864301 GATCTCTGTCTCTTACATGAGGG + Intronic
1090494152 11:127193416-127193438 TATTTCTGACCCTTCTGAGATGG + Intergenic
1091638866 12:2219124-2219146 AACTGCTGTCCCTTTTATGATGG + Intronic
1092594099 12:9981447-9981469 GATTTATCTCTCTTCTATAAAGG - Intronic
1093025031 12:14237877-14237899 GGGCTCTGTCCCTTCAATGAAGG - Intergenic
1094110743 12:26859681-26859703 AATTTCATTCCCTTCTTTGAGGG - Intergenic
1096570985 12:52523005-52523027 GCTTACTGTCCTTTCTCTGATGG - Intergenic
1097534310 12:60847410-60847432 CATTTGTTTCCCTTCTATCATGG - Intergenic
1098912392 12:76222427-76222449 GATTTCAGGACCTGCTATGACGG + Intergenic
1099576054 12:84383236-84383258 GATTTCTTTCTCTTGTCTGATGG + Intergenic
1100083452 12:90879241-90879263 AATCTCTGTCCTTTCCATGATGG - Intergenic
1101133481 12:101713560-101713582 CATTTGTTTCCCTTCTGTGAGGG + Intronic
1102465024 12:113124627-113124649 GATTTCTGAACCTTCTAGAAGGG + Intronic
1103232362 12:119342255-119342277 TATGTTTGTCCCTTTTATGAGGG + Intronic
1103852471 12:123942152-123942174 GGTTTCTGTCTCTTCTCTGGCGG + Intronic
1104380315 12:128301622-128301644 AATTTCTTTCCTTTCTTTGATGG - Intronic
1105375283 13:19838802-19838824 GCTGTCTGTCCCTTCTGTAAAGG + Exonic
1105516128 13:21092395-21092417 GACTTGTGTCCCTTTCATGAAGG + Intergenic
1107315096 13:39122584-39122606 GATTTCACTCCTTTTTATGAAGG - Intergenic
1107475768 13:40734305-40734327 GACTTCTGTCCCTTCTATGTTGG - Intronic
1108914164 13:55587860-55587882 AATCTCTGTCCTTTCCATGATGG + Intergenic
1110771802 13:79357638-79357660 GATTTTTGTCACTCCTATGGTGG - Intronic
1113319552 13:109220639-109220661 AACTTCTGTCCTTTCCATGATGG + Intergenic
1117322596 14:54638063-54638085 GATTTCTATCACTTCCAGGAAGG - Intronic
1117348721 14:54859736-54859758 GATTTCCGTCTCTTCTCTGAAGG - Exonic
1118880625 14:69822985-69823007 AATTTCTGCCCTTTCTATGATGG + Intergenic
1119570720 14:75669068-75669090 GGTTTCTTTCTCTTCTATAATGG - Intronic
1120750570 14:88193915-88193937 GTCCTCTGTCCCTTCTGTGAAGG + Intronic
1121230477 14:92354008-92354030 GTTTTGTGTCCCTCCCATGAGGG + Intronic
1122068053 14:99187358-99187380 GATTTCTGTGCCTTATCCGAAGG - Intronic
1122692769 14:103539031-103539053 GACATCTGTCCCTTCAAAGAGGG + Intergenic
1122841360 14:104465401-104465423 GATTTTTGCCCATTCTAAGAGGG + Intergenic
1123878073 15:24644940-24644962 AAACTCTGTCCCTTCCATGATGG + Intergenic
1126025412 15:44441633-44441655 GCTTTCTGTCTCTCCTAGGAAGG + Intronic
1126696804 15:51333261-51333283 CATTTTTGTCCCTTCTGAGAAGG - Intronic
1127387224 15:58476379-58476401 GACTTCTGTCCCTTAGAGGATGG - Intronic
1130140559 15:81222552-81222574 GAGTTCTGTACCTTCTGTGTTGG + Intronic
1131649687 15:94385231-94385253 GATGTCTGAATCTTCTATGATGG + Intronic
1132552020 16:557423-557445 GATGTCTGTCCTTTCAATAACGG - Intergenic
1135839660 16:25863518-25863540 TATTTCTGTCTCCACTATGAAGG + Intronic
1136949765 16:34702200-34702222 CATTTCAGTCCATTCAATGATGG + Intergenic
1137094070 16:36231131-36231153 CATTTCAGTCCATTCAATGATGG + Intergenic
1137312351 16:47276691-47276713 TATTTCTGTGCCTTCTATTTTGG - Intronic
1139373495 16:66482310-66482332 CATTTCTGTTCCTCCAATGAAGG + Intronic
1142655545 17:1390630-1390652 GATTCCTGTGCATTCTGTGATGG + Intronic
1144364042 17:14524986-14525008 GATTTGTGTCCCTTTAATGTTGG + Intergenic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1149737750 17:59012268-59012290 GAATTCTGTCCCTTTTTTGGTGG - Intronic
1151810234 17:76435839-76435861 GTTTTCTGTCCCCTCTGTGCCGG - Intronic
1152246837 17:79189038-79189060 GATTTCTGTCTCTCATCTGAAGG + Intronic
1154495597 18:14957403-14957425 GATTTCTGTTGCTTTTATGGAGG + Intergenic
1155071236 18:22318236-22318258 GACTTCATTCCCTTCTATCAGGG + Intergenic
1155398777 18:25415875-25415897 GATTTGTGTTCCTTCAAGGATGG + Intergenic
1155458872 18:26053832-26053854 GATTTCTGTTCCTTCAACAATGG - Intronic
1162528596 19:11222317-11222339 GATTTCTGTCACCTCCAAGATGG - Intronic
1165584644 19:36903396-36903418 CATTTCTGTCCTTTTTATAAAGG + Intronic
1168706507 19:58473294-58473316 CCTTTCTGTCCCTGCCATGAAGG - Exonic
925117104 2:1388894-1388916 GAATTCTGACCCGTCTAGGAAGG - Intronic
925146444 2:1586174-1586196 GATTTCTGTTCCTTCCATGGTGG - Intergenic
925560353 2:5185244-5185266 GATTTCTGTGCATTTTGTGAAGG - Intergenic
926318047 2:11725827-11725849 GATTTCTGGCCCTTCTTTTATGG + Intronic
930159704 2:48142298-48142320 GAGATATGTCCCTTCTATGCTGG + Intergenic
930225311 2:48786278-48786300 AACTTTTGTCCCTTCTCTGATGG + Intergenic
931938668 2:67228163-67228185 GATTTCTCTCACTTCTAGGTGGG - Intergenic
932924279 2:75953813-75953835 TATTTCTGTACCTGCTATCATGG - Intergenic
933057456 2:77690014-77690036 GATATCTGTCTCTCCTGTGATGG + Intergenic
935029939 2:99312047-99312069 ACTTTCTGCCCCTTCTCTGAGGG - Intronic
936520905 2:113211645-113211667 GATTTCTGTCCCTTCCCTTCTGG - Intergenic
937320175 2:120956322-120956344 GACTTCCCTCCCTTCCATGAGGG - Intronic
937852423 2:126647703-126647725 AATTTCTGCCCTTTCCATGATGG + Intergenic
939060260 2:137413508-137413530 GATTTATGTCACTTCAGTGAAGG - Intronic
940423363 2:153504372-153504394 GATTTCTTTCTCTTGTCTGATGG + Intergenic
942120825 2:172775042-172775064 CTTTTCTATCCCTCCTATGAAGG - Intronic
942206762 2:173626762-173626784 TATTTGTGTCCCTTGTATCACGG + Intergenic
943959233 2:194240169-194240191 TATTTCTTTGCCTTCTATAAAGG + Intergenic
945522331 2:210844183-210844205 GATTTATGTGCCTGCGATGAAGG + Intergenic
947916122 2:233832921-233832943 GATTTCTGTCCCTGTTAGGGTGG + Intronic
948340299 2:237245340-237245362 AAATTCTGTCCCTTACATGATGG + Intergenic
1168919808 20:1521836-1521858 GATTTCTGGCCCTTCCAACAGGG - Intergenic
1169505632 20:6208418-6208440 GATGTCTGTGGCTGCTATGATGG + Intergenic
1170285251 20:14700996-14701018 CTTTTATTTCCCTTCTATGAGGG + Intronic
1175270218 20:57728636-57728658 GCTTGCTGTCCCTTGTAGGAAGG + Intergenic
1177639527 21:23828683-23828705 TATTTATTTCCCTTCTTTGAAGG + Intergenic
1179062726 21:37994760-37994782 GTTGTCTGTCCCTTCTATCAAGG - Intronic
1180526386 22:16266483-16266505 CATTTCAGTCCATTCGATGATGG + Intergenic
1180527764 22:16312465-16312487 CATTTCAGTCCATTCGATGATGG + Intergenic
1180836803 22:18933994-18934016 GGGTCCTGTCCCTTCTGTGAGGG + Intronic
1181919710 22:26311209-26311231 GATTTCTGTCCATCCTGTGCTGG + Intronic
1182056904 22:27365607-27365629 GAATTCTGTCCCACCTAAGAGGG - Intergenic
1183584577 22:38745539-38745561 GTTTTCTGTGCCTTGTAAGATGG + Intronic
1184049777 22:41995995-41996017 GACTTCTCTCCCTTCTAAGCAGG + Intronic
1185031167 22:48443718-48443740 GGTTTCTGTCCCTTCTCTCAAGG + Intergenic
1203286896 22_KI270734v1_random:159293-159315 GGGTCCTGTCCCTTCTGTGAGGG + Intergenic
1203322036 22_KI270737v1_random:74658-74680 CATTTCAGTCCATTCGATGATGG - Intergenic
952238019 3:31500382-31500404 AATTTCTCTCCCTTCTTTGGTGG + Intergenic
954122335 3:48506738-48506760 AATTCCTGTCCCTTTTAAGAGGG - Intergenic
954440367 3:50518437-50518459 AATCTCTGCCCCTTCCATGAGGG - Intergenic
955801813 3:62694531-62694553 GATTTCTGTCCCTTCTATGATGG - Intronic
958086427 3:88814018-88814040 TATTTCTGTTCCTTGTAGGAGGG - Intergenic
965246144 3:166272455-166272477 GGTCTCTCTCCATTCTATGAAGG - Intergenic
965260558 3:166478407-166478429 GATCTCTGTCCCTCCTTTTAGGG - Intergenic
965780156 3:172277455-172277477 GACATCAGTCCCATCTATGAGGG + Intronic
966537260 3:181048837-181048859 CATTTCTTTCCCTTCTGTTAGGG - Intergenic
966661450 3:182419019-182419041 AAATTCTGCCCCTTCTGTGATGG - Intergenic
967914265 3:194566683-194566705 AAGTGCTGGCCCTTCTATGATGG + Intergenic
971597189 4:28545618-28545640 GATTTCTGTACCTTGTTTAATGG + Intergenic
973037980 4:45431600-45431622 CATTTCTCTCCCTTCTCTAAGGG - Intergenic
973931945 4:55802313-55802335 GATATCTGTTCATTCTATGGGGG + Intergenic
974801510 4:66824635-66824657 AAGGTATGTCCCTTCTATGAAGG + Intergenic
975171937 4:71242010-71242032 GATTTCTTTCACTTCAAGGAAGG + Intronic
977346316 4:95821137-95821159 AAGTTCTTTCCCTCCTATGAGGG - Intergenic
978347071 4:107782497-107782519 GATTGCTGTAACTTCTTTGAAGG + Intergenic
978485776 4:109252196-109252218 AAATGCTGCCCCTTCTATGATGG + Intronic
981674181 4:147322204-147322226 GTCTTCTTTCCCTTCTATTACGG - Intergenic
981979237 4:150771589-150771611 AAATGCTGCCCCTTCTATGATGG + Intronic
982897898 4:160957312-160957334 GTTTTCTGTCCCTTCTTCCATGG - Intergenic
982988294 4:162238408-162238430 GATTTCTGACCATTCTGGGATGG + Intergenic
986078749 5:4366767-4366789 GATTACGGTGCCTCCTATGAGGG - Intergenic
986793946 5:11191263-11191285 GATTTCTCTGCTTTTTATGATGG - Intronic
987181170 5:15369742-15369764 GATTTCTTTCTCTTTTATGGTGG - Intergenic
987437876 5:17919517-17919539 GTTTTCTTTGCTTTCTATGAGGG + Intergenic
989437663 5:41433755-41433777 GTTTTCTCTCCCTCCTGTGAGGG - Intronic
989521802 5:42411174-42411196 GATCTGTGTGCCTTTTATGAAGG + Intergenic
991589813 5:68238480-68238502 ACTTTCTGTCCCTTTCATGAGGG - Intronic
992099798 5:73396034-73396056 CAGTGCTGTCCCTTCTATTATGG - Intergenic
993951215 5:94177883-94177905 AATTACTGTCCCTTCTCTTATGG + Intronic
994793812 5:104267381-104267403 GATTTTTGTCCCTGCCCTGATGG + Intergenic
995797176 5:115953864-115953886 GATTTATGTCCCTCTTATTAAGG + Intergenic
996245547 5:121259658-121259680 GATTTCTTTCCCTTGCTTGATGG + Intergenic
996412583 5:123174669-123174691 GATTTCTTTCCTTTATATCAAGG - Intronic
996848525 5:127927786-127927808 GATTTCTGGCTCTCCTATAATGG + Intergenic
998925646 5:147122851-147122873 AATTTCTCTTTCTTCTATGATGG + Intergenic
999351523 5:150875864-150875886 AATTGCTGTCCTTTCCATGATGG - Intronic
1007018072 6:38489594-38489616 AATTTCTGTAACTTCTAGGACGG + Intronic
1007201750 6:40115495-40115517 TATTCCTGGCCCTTCTAAGATGG - Intergenic
1007630749 6:43271997-43272019 GTTTTCTGTCCCTTCTCAAAGGG - Intronic
1008358763 6:50589457-50589479 TATTACTTTCCCTTCTATTAGGG + Intergenic
1009254167 6:61355005-61355027 TATTTTTGTCCATTCTGTGAAGG + Intergenic
1009258853 6:61456826-61456848 TATTTTTGTCCATTCTGTGAAGG + Intergenic
1010091756 6:71990960-71990982 GAATTCTGTCACATCTAAGAAGG + Intronic
1010205257 6:73316744-73316766 GATTTTGGTCCCAACTATGAGGG + Intergenic
1011336097 6:86261261-86261283 AACTTCTGTTCCTTCTCTGAGGG + Intergenic
1011453334 6:87519064-87519086 GATTTCTTTCCCTTTAATGTAGG - Intronic
1011547825 6:88500166-88500188 GACTTCTGCTACTTCTATGATGG - Intergenic
1012017990 6:93876946-93876968 TATTTCTGTCAGTTCTTTGAAGG - Intergenic
1012195016 6:96330727-96330749 GACTTCTGAGCCTTCTCTGAAGG + Intergenic
1013202070 6:107907892-107907914 GATTTCTGTTTCTTTTCTGAGGG - Intronic
1013838357 6:114359765-114359787 GATTTTTGTCACTTCTTTAAAGG - Intergenic
1014321438 6:119933538-119933560 CATTTCAGCCCCTTCTATCAAGG + Intergenic
1015502678 6:133950733-133950755 GATTGCTGACCCTTGTATTAGGG - Intergenic
1015787941 6:136937175-136937197 GATTTCTGTCACTCCTCTGGGGG + Intergenic
1017499202 6:155007640-155007662 CATTTCTGTCTCTTCAATAAAGG + Intronic
1019866594 7:3717085-3717107 GATTTCAGTCCTTCCTTTGAAGG + Intronic
1021304972 7:19021533-19021555 AAATGCTGCCCCTTCTATGATGG + Intronic
1023861210 7:44218578-44218600 GGTGTCTGTCCCTTCTCTGCTGG - Exonic
1026808170 7:73440895-73440917 GTCTTCTTTCCCTTTTATGATGG - Exonic
1026929693 7:74217000-74217022 ACTTTCTCTCCCTTCTCTGATGG - Intronic
1028609064 7:92688489-92688511 GACTTTTGTCCCTTCTATGTCGG + Intronic
1031596643 7:123657045-123657067 GATTTCTGTCTCCTTTACGATGG + Intronic
1031981549 7:128130091-128130113 GATTTTTGTCATTTCTATTATGG + Intergenic
1033576401 7:142689500-142689522 GATTTCTCTTCCTTCTCTCAAGG - Intergenic
1035139675 7:156745781-156745803 GATTGCTGTCTCTTCAGTGATGG - Intronic
1038540009 8:28384524-28384546 TCCTTCTGTCCCCTCTATGAGGG + Intronic
1039990997 8:42487506-42487528 GCTTTCTGCCCCTTCTCTGTCGG + Intronic
1042811181 8:72826859-72826881 AATTTCTGTGCCATTTATGATGG + Intronic
1043734885 8:83730239-83730261 CATTTCTCTCCCTTGTTTGAAGG - Intergenic
1044151333 8:88778798-88778820 GCTTTCTGTCTCTTCAATAAAGG + Intergenic
1044346689 8:91112372-91112394 GATCTCTTTTCCTTCTATCAGGG - Intronic
1046773143 8:118136558-118136580 GATTTCTTTCCCATCTAAGGAGG - Intergenic
1047270287 8:123351432-123351454 GATATCTGTCCCTTCGGGGAGGG + Intronic
1048799604 8:138183929-138183951 GAACTCAGTCCCTTCTATGCAGG + Intronic
1051210811 9:14740767-14740789 AATTTCTGTGCATTATATGAAGG - Intronic
1052839633 9:33280950-33280972 GGTTTCTTTCCTTTCTTTGAAGG + Exonic
1052978743 9:34431501-34431523 GATTTCTGTGGTATCTATGAGGG - Intronic
1052990876 9:34518829-34518851 CATGTCTGACCCTTCTCTGAGGG - Intronic
1052990896 9:34518914-34518936 CATGTCTGACCCTTCTCTGAGGG - Intronic
1053814321 9:41890190-41890212 CATTTCTGTCACTTATATTATGG + Intergenic
1053947287 9:43324435-43324457 CATTTCAGTCCATTCAATGACGG + Intergenic
1053947342 9:43325163-43325185 CATTTCAGTCCATTCGATGACGG + Intergenic
1053947417 9:43326136-43326158 CATTTCAGTCCATTCGATGACGG + Intergenic
1054362264 9:64185718-64185740 TATTTTTGTCCATTCTGTGAAGG + Intergenic
1054616275 9:67297250-67297272 CATTTCTGTCACTTATATTATGG - Intergenic
1056778190 9:89529303-89529325 GCTATCTGTCCCTTACATGATGG - Intergenic
1057059132 9:91987571-91987593 AAACTCTGTCCCTTCCATGATGG - Intergenic
1058293287 9:103272231-103272253 AATTTCTGTCTCATCTAGGAGGG - Intergenic
1059926500 9:119214763-119214785 AAATTCTGTCTCCTCTATGAAGG - Intronic
1059934712 9:119298191-119298213 GATTCCTTTCCCTGCTCTGATGG - Intronic
1060178936 9:121518328-121518350 GAATGCTGCCCCTTCCATGATGG - Intergenic
1061653809 9:132072333-132072355 GATTTTTTTCCCTTGTATCAAGG + Intronic
1062038886 9:134395247-134395269 GATTTCTGTCCCTCCCTTGGCGG + Intronic
1203590417 Un_KI270747v1:52993-53015 CATTTCAGTCCATTCAATGACGG + Intergenic
1203590546 Un_KI270747v1:54694-54716 CATTTCAGTCCATTCGATGACGG + Intergenic
1186089397 X:6028303-6028325 GATTTCAGTACCTTCTGAGATGG - Intronic
1187444591 X:19350084-19350106 GGTTTCTGTCACTTGTGTGATGG + Exonic
1189235977 X:39487692-39487714 GATTTCTGTTCCTAGTATAAAGG - Intergenic
1193218521 X:78894799-78894821 TATTTCTTTCCCTTGTCTGAAGG + Intergenic
1193450521 X:81659003-81659025 GTTTTCTGTCACTTTTCTGATGG + Intergenic
1194453844 X:94078347-94078369 GGTTTTTGTCCCTTCTCAGATGG - Intergenic
1199348786 X:146775055-146775077 GGTCTCTGTCATTTCTATGAAGG + Intergenic
1201529523 Y:14976876-14976898 AACTTCTGCCCTTTCTATGATGG + Intergenic
1201918187 Y:19205150-19205172 TACTTCAGTCCCTGCTATGAAGG - Intergenic