ID: 955801814

View in Genome Browser
Species Human (GRCh38)
Location 3:62694553-62694575
Sequence CAGTCCTCATTGTAATATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955801812_955801814 3 Left 955801812 3:62694527-62694549 CCTTCCATCATAGAAGGGACAGA 0: 1
1: 0
2: 3
3: 29
4: 184
Right 955801814 3:62694553-62694575 CAGTCCTCATTGTAATATTCTGG 0: 1
1: 0
2: 0
3: 10
4: 114
955801810_955801814 5 Left 955801810 3:62694525-62694547 CCCCTTCCATCATAGAAGGGACA 0: 1
1: 5
2: 35
3: 228
4: 420
Right 955801814 3:62694553-62694575 CAGTCCTCATTGTAATATTCTGG 0: 1
1: 0
2: 0
3: 10
4: 114
955801811_955801814 4 Left 955801811 3:62694526-62694548 CCCTTCCATCATAGAAGGGACAG 0: 1
1: 1
2: 2
3: 20
4: 178
Right 955801814 3:62694553-62694575 CAGTCCTCATTGTAATATTCTGG 0: 1
1: 0
2: 0
3: 10
4: 114
955801813_955801814 -1 Left 955801813 3:62694531-62694553 CCATCATAGAAGGGACAGAAATC 0: 1
1: 0
2: 1
3: 9
4: 235
Right 955801814 3:62694553-62694575 CAGTCCTCATTGTAATATTCTGG 0: 1
1: 0
2: 0
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955801814 Original CRISPR CAGTCCTCATTGTAATATTC TGG Intronic