ID: 955801979

View in Genome Browser
Species Human (GRCh38)
Location 3:62696093-62696115
Sequence CAGTAGTCAAAGAGGTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955801973_955801979 8 Left 955801973 3:62696062-62696084 CCCTACATATAAAAGTGTAGGTC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 955801979 3:62696093-62696115 CAGTAGTCAAAGAGGTGACCTGG 0: 1
1: 0
2: 0
3: 6
4: 182
955801972_955801979 9 Left 955801972 3:62696061-62696083 CCCCTACATATAAAAGTGTAGGT 0: 1
1: 0
2: 0
3: 10
4: 147
Right 955801979 3:62696093-62696115 CAGTAGTCAAAGAGGTGACCTGG 0: 1
1: 0
2: 0
3: 6
4: 182
955801970_955801979 15 Left 955801970 3:62696055-62696077 CCTTGACCCCTACATATAAAAGT 0: 1
1: 0
2: 0
3: 14
4: 135
Right 955801979 3:62696093-62696115 CAGTAGTCAAAGAGGTGACCTGG 0: 1
1: 0
2: 0
3: 6
4: 182
955801969_955801979 22 Left 955801969 3:62696048-62696070 CCAAGGGCCTTGACCCCTACATA 0: 1
1: 0
2: 2
3: 17
4: 93
Right 955801979 3:62696093-62696115 CAGTAGTCAAAGAGGTGACCTGG 0: 1
1: 0
2: 0
3: 6
4: 182
955801974_955801979 7 Left 955801974 3:62696063-62696085 CCTACATATAAAAGTGTAGGTCT 0: 1
1: 0
2: 2
3: 10
4: 150
Right 955801979 3:62696093-62696115 CAGTAGTCAAAGAGGTGACCTGG 0: 1
1: 0
2: 0
3: 6
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955801979 Original CRISPR CAGTAGTCAAAGAGGTGACC TGG Intronic
900437176 1:2636514-2636536 CAAAATTCAGAGAGGTGACCTGG - Intronic
906330142 1:44877531-44877553 CAGTGGTCCAGGAGGTGACCAGG - Intronic
908831311 1:68181316-68181338 CATTAGTCAATGATGTCACCAGG + Intronic
912770304 1:112457304-112457326 CAGTGGTCAAAGAGGCTGCCTGG - Exonic
915519627 1:156434366-156434388 CAGCAGTAAAAGTGGTGGCCAGG - Intergenic
918284066 1:183034859-183034881 AAGAATTCAAAGAGGTAACCAGG - Intronic
920819272 1:209365166-209365188 CTGTAGTCAAAGTGGTTATCAGG - Intergenic
924598904 1:245470723-245470745 CAGGGGTCAAAGTGGTGGCCGGG - Intronic
1063171247 10:3511829-3511851 CAGTATGCAAGGAGATGACCCGG - Intergenic
1064694210 10:17949502-17949524 CAGCAGTCAAAGAGGGCAGCAGG - Intergenic
1065602306 10:27381775-27381797 CAAGAGTCAAAGAGGGGACAAGG - Intergenic
1067118802 10:43456456-43456478 CAGCTGTCAGAGAGGTGAGCTGG + Intronic
1067639893 10:48035768-48035790 CAGTAGGCAAAGTAGTGAACTGG + Intergenic
1068721633 10:60252262-60252284 CAGTGCTCAAGGAGGGGACCAGG + Intronic
1068815372 10:61303926-61303948 GAGGAGTCAAAGAGGTGGTCTGG + Intergenic
1069239243 10:66118291-66118313 CAGTAGTCTTAGACGTCACCAGG + Intronic
1071263492 10:83942881-83942903 GAGTAGTCACAGAGGTAAACAGG - Intergenic
1073914338 10:108384831-108384853 CATTAATCTAAAAGGTGACCAGG + Intergenic
1075876850 10:125814656-125814678 GACAAGTCAAAGAGGTGACTGGG + Intronic
1075921227 10:126215117-126215139 CAGAAGTCACAGATGTGAGCAGG - Intronic
1076555986 10:131321688-131321710 CAGTAGTCAAGGAAGTTAACTGG + Intergenic
1076655569 10:132021443-132021465 AGGTAGTCAAGGAAGTGACCAGG - Intergenic
1077332759 11:1990584-1990606 CTGGAGGCAAAGAGGTGCCCGGG - Intergenic
1077458433 11:2695013-2695035 CAGTGGTCAGAGAGGTAAGCAGG + Intronic
1079367814 11:19824572-19824594 CAATAGTCAAATAGGTGAAATGG - Intronic
1080774388 11:35372099-35372121 GAGTAAACAAAGAGGTGACTTGG + Intronic
1084291926 11:68177398-68177420 CTGGATTCAAAGAGTTGACCAGG + Intronic
1085443077 11:76580488-76580510 CCTTAGGCAAAAAGGTGACCTGG + Intergenic
1085958586 11:81432115-81432137 CTGAAGTCAAAGCGTTGACCTGG - Intergenic
1088283130 11:108157047-108157069 AAGTATTCAAATAGGTTACCAGG + Intergenic
1090458676 11:126870712-126870734 CAGGAGTCCAAGAGGTCACGAGG + Intronic
1202815742 11_KI270721v1_random:45760-45782 CTGGAGGCAAAGAGGTGCCCGGG - Intergenic
1091835528 12:3583147-3583169 CAATATTAAAATAGGTGACCAGG - Exonic
1097320198 12:58217051-58217073 CTATAGTCAGAGAGGTGACATGG - Intergenic
1103750144 12:123152546-123152568 CTGTAGTCATAGAGATGACATGG + Intronic
1103947560 12:124535087-124535109 TAGCAGGCAAAGAGGTGGCCTGG - Intronic
1106672206 13:31918089-31918111 CAGCAGGCATAGAGGTGTCCAGG - Intergenic
1106848595 13:33764116-33764138 CTGTAGTCAATGAGATGACAAGG + Intergenic
1108172882 13:47761485-47761507 CAGCTGGCAAAGAGTTGACCAGG + Intergenic
1112330359 13:98472747-98472769 CATAAGTCAAAGAGGTTGCCTGG - Intronic
1112714059 13:102163634-102163656 CAGTATTCGAGGAGGTGATCTGG + Intronic
1113281190 13:108789664-108789686 CAGAAGTAAAAGAGCTGAGCAGG - Intronic
1113919034 13:113895790-113895812 CTGTAGTCATAGAGATGACGTGG + Intergenic
1114249765 14:20948670-20948692 CTGTAGTCTAATAGGTGATCGGG + Intergenic
1121418696 14:93797339-93797361 CAGTATTCTAAGAGCTGAGCAGG + Intergenic
1122258716 14:100499849-100499871 CAGAACTCAAAGGGGTGGCCAGG + Intronic
1125053386 15:35328291-35328313 CAGGTGTCAAAGGGGTTACCAGG - Intronic
1125555184 15:40578848-40578870 CAGAAGTCAAAGGGCTGTCCAGG - Intergenic
1126217807 15:46176528-46176550 CAGAAGCCAAAGAGGAAACCAGG - Intergenic
1126335659 15:47583841-47583863 CAGAGGTCAAAGAGGTTACTGGG + Intronic
1128785520 15:70394137-70394159 TATTAGTCAAAGAGGTGCCTGGG - Intergenic
1131101580 15:89694533-89694555 CAGTAATAAAAGAAGTAACCCGG - Intronic
1132814662 16:1820016-1820038 TAGAAGTCAAACAGGAGACCTGG + Intronic
1134198065 16:12174343-12174365 CTGCAGTCAAAGAGGTCACTAGG - Intronic
1138406362 16:56797609-56797631 CATTAGTGAAAGAGATGCCCAGG - Intronic
1146292463 17:31619600-31619622 AAATAGTCAAAGAAGTGACAAGG - Intergenic
1148128951 17:45251074-45251096 CAGAAAACAAACAGGTGACCAGG - Intergenic
1150852269 17:68714971-68714993 CAGTAGTCACAGGGGGGACACGG - Intergenic
1151809551 17:76429951-76429973 CAGAATTCAAAGAGATGACTTGG + Intronic
1153392044 18:4573601-4573623 CATTCATTAAAGAGGTGACCTGG + Intergenic
1156294096 18:35774306-35774328 CAGAAGTCAGAGAGCTGACTTGG + Intergenic
1157655606 18:49384732-49384754 CAATAGTAAAAGAGGAGAACTGG + Intronic
1158332919 18:56382736-56382758 AAGTAGTCTAAGAGGTTAGCTGG - Intergenic
1158750487 18:60253742-60253764 CAGTAGTGAAAAAGGAGGCCTGG - Intergenic
1159057206 18:63477878-63477900 CAGAACTCACAGAGGTGATCTGG + Intronic
1162451166 19:10756106-10756128 CAGTAGTCACAGTGGACACCAGG - Intronic
1163458188 19:17420868-17420890 CAGTAGTGAAACAGGTGGCGTGG - Intronic
1165010537 19:32843160-32843182 CAGATGTCAAAGGGGTGGCCAGG + Intronic
1167499878 19:49839766-49839788 CAGAAATGAAAGAGGTGGCCCGG + Intergenic
1168286130 19:55334721-55334743 CACTTGTCAAAGGGGGGACCAGG + Intergenic
931705972 2:64946460-64946482 CAGTGGTCTCAGAGGTGTCCAGG + Intergenic
934718198 2:96555178-96555200 CAGGACTCAAGGAGGTGGCCTGG + Intergenic
935304912 2:101728087-101728109 CTGTACTTAAAGAGGTAACCTGG - Intronic
937430560 2:121834567-121834589 CAGAAGGAATAGAGGTGACCAGG + Intergenic
937478941 2:122239605-122239627 TGGTAGGAAAAGAGGTGACCAGG + Intergenic
937605938 2:123801813-123801835 CAGTAGTCATTGAGGAGAGCAGG + Intergenic
937941293 2:127288147-127288169 AAGTGGTCAAACAGGTGCCCAGG + Intronic
940905337 2:159164147-159164169 CAGTAGTCAGACTGGTCACCAGG + Intronic
942040444 2:172056539-172056561 CAGTGGTGAATGAGGTGACAAGG - Intronic
944278198 2:197864073-197864095 TTTTAGTCTAAGAGGTGACCAGG - Intronic
1171292477 20:23990199-23990221 CAGGAATCAGCGAGGTGACCTGG - Intergenic
1171558942 20:26104160-26104182 CACAAGTCAGAGAAGTGACCTGG + Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173970850 20:47151029-47151051 CAGTAGCCAGAGAGGTGAAAAGG + Intronic
1173997084 20:47346557-47346579 CAGTAGTCAAGGCTGGGACCTGG - Intronic
1179609987 21:42543951-42543973 CAGAAGGCAAAGAGCTGACTGGG - Intronic
1180732247 22:17990886-17990908 CAGTAGTAAAAGAGGTCAAGGGG - Intronic
1180823544 22:18847960-18847982 CAGGAATCAGCGAGGTGACCTGG - Exonic
1181097117 22:20513038-20513060 CTGTAATACAAGAGGTGACCCGG - Intronic
1181123972 22:20691059-20691081 CAGGAATCAGCGAGGTGACCTGG - Intergenic
1181189195 22:21126586-21126608 CAGGAATCAGCGAGGTGACCTGG + Exonic
1181210004 22:21283909-21283931 CAGGAATCAGCGAGGTGACCTGG - Intergenic
1181399515 22:22643035-22643057 CAGGAATCAGCGAGGTGACCTGG + Intergenic
1181649903 22:24253033-24253055 CAGGAATCAGCGAGGTGACCTGG - Intergenic
1181707475 22:24657713-24657735 CAGGAATCAGCGAGGTGACCTGG + Intergenic
1184683311 22:46084744-46084766 CAGTTTCCAAAGAGGTGAGCTGG + Intronic
1185251748 22:49805628-49805650 CAGCAGGCCATGAGGTGACCAGG - Intronic
1203216943 22_KI270731v1_random:11524-11546 CAGGAATCAGCGAGGTGACCTGG + Intergenic
1203273687 22_KI270734v1_random:73866-73888 CAGGAATCAGCGAGGTGACCTGG - Intergenic
955030357 3:55210479-55210501 CAGTAGCCAATGAGGTCAACTGG + Intergenic
955801979 3:62696093-62696115 CAGTAGTCAAAGAGGTGACCTGG + Intronic
956250514 3:67229904-67229926 CAGTTGTCACATAGGTGACAGGG + Intergenic
959385444 3:105699725-105699747 CAGTAATAAAAGAGGAGACATGG + Intronic
959652057 3:108760009-108760031 AAGAAGTCAGAGAGCTGACCAGG + Intergenic
961696926 3:128711828-128711850 CAGTTCTCAAAGTGGTGACATGG + Intergenic
965251485 3:166349399-166349421 CAGGAATTCAAGAGGTGACCAGG + Intergenic
967119161 3:186367349-186367371 CAGGAGATAAAGAAGTGACCAGG - Intergenic
967876300 3:194270541-194270563 CAGTTTTCAAAGTGGTGCCCTGG - Intergenic
968903791 4:3442788-3442810 CAGAGGTCACAGAGGTCACCAGG - Exonic
969298543 4:6283684-6283706 CTGTAGTCAGGGAGATGACCTGG + Intronic
979528396 4:121741360-121741382 CTGTAGTCAAATAGGTGGTCAGG - Intergenic
981003354 4:139850382-139850404 CACTAACCAAAGAGGTCACCAGG - Intronic
984766968 4:183407166-183407188 CAGCGGTCACAGAGGTGACGCGG - Intergenic
984918687 4:184745158-184745180 CAGGAGTCCTAAAGGTGACCTGG + Intergenic
985761343 5:1750785-1750807 CAGGAGACAATGAGGTGAGCTGG - Intergenic
987708320 5:21482277-21482299 CAGGAATCAGCGAGGTGACCTGG + Intergenic
987708496 5:21483084-21483106 CAGGAATCATCGAGGTGACCTGG + Intergenic
988751115 5:34191061-34191083 CAGGAATCATCGAGGTGACCTGG - Intergenic
988751293 5:34191871-34191893 CAGGAATCATCGAGGTGACCTGG - Intergenic
988751460 5:34192678-34192700 CAGGAATCATCGAGGTGACCTGG - Intergenic
991449021 5:66732087-66732109 CAGTAGTCTAGGAAGTGAACTGG - Intronic
991736258 5:69632985-69633007 CAGGAATCATCGAGGTGACCTGG - Intergenic
991736429 5:69633792-69633814 CAGGAATCAGCGAGGTGACCTGG - Intergenic
991736604 5:69634605-69634627 CAGGAATCAGCGAGGTGACCTGG - Intergenic
991758287 5:69899722-69899744 CAGGAATCAGCGAGGTGACCTGG + Intergenic
991758461 5:69900538-69900560 CAGGAATCAGCGAGGTGACCTGG + Intergenic
991758809 5:69902158-69902180 CAGGAATCATCGAGGTGACCTGG + Intergenic
991812754 5:70488624-70488646 CAGGAATCATCGAGGTGACCTGG - Intergenic
991812927 5:70489431-70489453 CAGGAATCAGCGAGGTGACCTGG - Intergenic
991815713 5:70509101-70509123 CAGGAATCATCGAGGTGACCTGG - Intergenic
991815885 5:70509908-70509930 CAGGAATCAGCGAGGTGACCTGG - Intergenic
991816058 5:70510721-70510743 CAGGAATCAGCGAGGTGACCTGG - Intergenic
991837690 5:70775604-70775626 CAGGAATCAGCGAGGTGACCTGG + Intergenic
991838038 5:70777224-70777246 CAGGAATCATCGAGGTGACCTGG + Intergenic
994420221 5:99522472-99522494 CAGGAATCAGCGAGGTGACCTGG + Intergenic
994420390 5:99523291-99523313 CAGGAATCAGCGAGGTGACCTGG + Intergenic
994486653 5:100391023-100391045 CAGGAATCAGCGAGGTGACCTGG - Intergenic
994486985 5:100392661-100392683 CAGGAATCAGCGAGGTGACCTGG - Intergenic
997112314 5:131088500-131088522 CAGTAGCCAATGAGGTCAACTGG + Intergenic
997653446 5:135538472-135538494 CAGTGGTGGAAGAGGTGGCCAGG + Intergenic
998869474 5:146537795-146537817 CAGAAGTGACAGAGGTGAGCAGG - Intergenic
1005267250 6:24125402-24125424 CAATATTCAAAGAGGTGAGAAGG + Intergenic
1005549265 6:26897690-26897712 CAGGAATCAGCGAGGTGACCTGG - Intergenic
1005549442 6:26898507-26898529 CAGGAATCAGCGAGGTGACCTGG - Intergenic
1005549618 6:26899327-26899349 CAGGAATCAGCGAGGTGACCTGG - Intergenic
1005549792 6:26900144-26900166 CAGGAATCAGCGAGGTGACCTGG - Intergenic
1005982520 6:30847390-30847412 CAGTAGTGAAAGGGTTGCCCAGG - Intergenic
1006134521 6:31887770-31887792 CAGGAGTCAGAGAGGTGAGTGGG - Exonic
1007203833 6:40133026-40133048 CAGTTGTCACATAGGTGACAGGG - Intergenic
1009020007 6:57938800-57938822 CAGGAATCAGCGAGGTGACCTGG - Intergenic
1010208390 6:73343207-73343229 AAGAAGTCAAAGAAGAGACCTGG - Intergenic
1011308921 6:85959711-85959733 TAGTACTCAAAGAGATGCCCTGG + Intergenic
1011447648 6:87459518-87459540 CATTAATCAATGAGGGGACCAGG + Intronic
1014952739 6:127577294-127577316 CTGTAGTCACTGAGCTGACCAGG - Exonic
1016376594 6:143427447-143427469 CTGTAGTCATGGAGGTGAACTGG + Exonic
1017090439 6:150754329-150754351 CAGTGGTCAAAGATGAGCCCAGG + Intronic
1022569768 7:31440867-31440889 CAGCAGTCATAGATGTGACATGG + Intergenic
1024001208 7:45190491-45190513 CCTTAGTCAAGGAGCTGACCAGG + Intergenic
1025115594 7:56255465-56255487 CAGAAGCCAAAGAGGAGACCTGG + Intergenic
1026199990 7:68206376-68206398 CAGAAGCCAAAGAGGAGACCTGG + Intergenic
1026450578 7:70525786-70525808 CAGAAGTGAGAGAGGTGGCCTGG + Intronic
1027178396 7:75919829-75919851 CACTTGTTAAAGAGGTGACTTGG + Intronic
1030538171 7:110794962-110794984 CAGAAGTCAAAGACTGGACCAGG - Intronic
1031094411 7:117402174-117402196 CAGTTGTCAAACAGGTGACAGGG + Intronic
1031464255 7:122089062-122089084 CAGAAGTCAGAGAGGTGACTTGG + Intronic
1033352904 7:140576750-140576772 CAGTAGAGGAAGAGCTGACCTGG + Intronic
1033709722 7:143929843-143929865 CTGTCCTCAAAGAGCTGACCTGG - Intergenic
1035269590 7:157711610-157711632 CAGAAGACAAAGAGGAGAGCAGG - Intronic
1035318407 7:158012699-158012721 CCATGGTCCAAGAGGTGACCTGG - Intronic
1035908160 8:3536464-3536486 CATTAATCAAAGAGGAAACCTGG - Intronic
1040658050 8:49535099-49535121 CAGTAGACAAAGAGTTGAACTGG - Intergenic
1042288984 8:67147835-67147857 CAGGAGTAAAAGAGATGACATGG - Intronic
1042678893 8:71356968-71356990 CAGGAGTCAAAGGGGTGGGCGGG - Intronic
1044695494 8:94918442-94918464 TAGTAATTAAAGAGCTGACCAGG - Intronic
1048685695 8:136902999-136903021 CAATAGTCCAAGATGTGACTAGG + Intergenic
1048973336 8:139657342-139657364 CATTAGTCACAGAGGTGATGAGG + Intronic
1050277174 9:4011956-4011978 CAGAAGTCAGAAAGGTGACAGGG + Intronic
1053033493 9:34803513-34803535 CAGGAGTGTAAGAGGGGACCAGG + Intergenic
1056798966 9:89678188-89678210 CAGGGGTCAAAGAGGGGAGCTGG + Intergenic
1203440942 Un_GL000219v1:8157-8179 CAGTAGCCAATGAGATCACCTGG - Intergenic
1186944879 X:14554684-14554706 CATTAGTCAATGAGGGAACCAGG + Intronic
1187977645 X:24719461-24719483 AAATAGTCAAAGAGGTGAGGGGG - Intronic
1190732883 X:53236257-53236279 CAGGAGGCAAAGAGGACACCCGG + Intronic
1192157006 X:68754154-68754176 ATGTAGTCAAAGAGGTGGCAAGG - Intergenic
1193106648 X:77683027-77683049 CAATCCTCAAAGAGGTGAGCAGG - Exonic
1194465894 X:94235085-94235107 CAGGAGACCAAGAGGTGCCCAGG - Intergenic
1194970784 X:100341314-100341336 CATTAGTCATAGGGGAGACCAGG - Intronic
1198540164 X:137629534-137629556 TAGTTGTCAAAAAAGTGACCTGG + Intergenic
1198751810 X:139943791-139943813 CAGTAGCCAAGGAGTTGGCCAGG - Intronic