ID: 955803244

View in Genome Browser
Species Human (GRCh38)
Location 3:62707317-62707339
Sequence AGACCCGGGGTTGCAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955803244_955803254 27 Left 955803244 3:62707317-62707339 CCATCCCCTGCAACCCCGGGTCT 0: 1
1: 0
2: 1
3: 33
4: 319
Right 955803254 3:62707367-62707389 GTCCGTGATCCCAAAAAGGTTGG 0: 1
1: 3
2: 94
3: 1323
4: 1906
955803244_955803252 23 Left 955803244 3:62707317-62707339 CCATCCCCTGCAACCCCGGGTCT 0: 1
1: 0
2: 1
3: 33
4: 319
Right 955803252 3:62707363-62707385 ACCAGTCCGTGATCCCAAAAAGG 0: 1
1: 0
2: 49
3: 668
4: 1018
955803244_955803255 28 Left 955803244 3:62707317-62707339 CCATCCCCTGCAACCCCGGGTCT 0: 1
1: 0
2: 1
3: 33
4: 319
Right 955803255 3:62707368-62707390 TCCGTGATCCCAAAAAGGTTGGG 0: 1
1: 2
2: 91
3: 1341
4: 1848
955803244_955803257 29 Left 955803244 3:62707317-62707339 CCATCCCCTGCAACCCCGGGTCT 0: 1
1: 0
2: 1
3: 33
4: 319
Right 955803257 3:62707369-62707391 CCGTGATCCCAAAAAGGTTGGGG 0: 1
1: 2
2: 83
3: 1347
4: 1769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955803244 Original CRISPR AGACCCGGGGTTGCAGGGGA TGG (reversed) Intronic
900154855 1:1199811-1199833 GGGCCCTGGGTTGCAGGGGGTGG - Intergenic
900390099 1:2430082-2430104 AGACTTGGGGTTTCAGGGCAGGG + Intronic
900394308 1:2446878-2446900 ACACACGGGGCTGCAGGGGCAGG - Intronic
900534611 1:3170690-3170712 GGGCCCGGGGGAGCAGGGGAAGG + Intronic
900920557 1:5667706-5667728 AGACGCTGGGGTGCAGGGGAGGG - Intergenic
900920604 1:5667902-5667924 AGACGCTGGAGTGCAGGGGAGGG - Intergenic
901167882 1:7232666-7232688 AGACCGGTGTTTGCAGGGGCCGG + Intronic
902245389 1:15117475-15117497 AGACCCCAGGCTGCAGAGGAGGG + Exonic
902336210 1:15756420-15756442 AGACCCTGAGTGGCAGGGAAGGG - Intergenic
902377112 1:16035085-16035107 GGACCCCGGGGTCCAGGGGAGGG - Intergenic
902532213 1:17097767-17097789 AGAGCCTGGGGTGCAGGGGCAGG + Intronic
902748995 1:18493570-18493592 TGAACTGGGGTGGCAGGGGATGG - Intergenic
902922717 1:19676626-19676648 AGAGCCGGGGCTGGAGGAGAGGG + Intronic
903034252 1:20484596-20484618 AGACGCAGGGATGGAGGGGAGGG - Intronic
903360147 1:22772029-22772051 ACACCAGGGCTTGCTGGGGAAGG - Intronic
903442945 1:23401934-23401956 GGACCAGGGTTTGTAGGGGATGG - Intronic
903512582 1:23887322-23887344 AGTCCCTGGGTGGCAGGTGATGG - Intronic
904567743 1:31437847-31437869 AGGCATGGGGTTACAGGGGAAGG - Intergenic
905627364 1:39497903-39497925 GGACCTGGGGTCCCAGGGGAGGG - Intronic
905669065 1:39779208-39779230 GGACTTGGGGTTCCAGGGGAGGG + Intronic
906104825 1:43285514-43285536 AGGCCCGGGGGGGCCGGGGAGGG - Exonic
908582707 1:65532797-65532819 AGATCAGTGGTTGCCGGGGATGG + Intronic
910305404 1:85757027-85757049 AGAACGGTGGTTGCAGGGGCTGG + Intronic
913962946 1:143353665-143353687 AGTCCCGGGGTTGCGGGGCTGGG - Intergenic
914003909 1:143716447-143716469 AGAGCCGGGGTGGCAGGGATGGG + Intergenic
914050229 1:144125198-144125220 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
914057301 1:144179250-144179272 AGTCCCGGGGTTGCGGGGCTGGG - Intergenic
914121845 1:144787116-144787138 AGTCCCGGGGTTGCGGGGCTGGG + Intergenic
914128953 1:144840247-144840269 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
915105994 1:153535496-153535518 AGCCCAGGGCTTGAAGGGGAAGG + Intronic
915298360 1:154937567-154937589 AGAACCGGGGATGCAGGGAAAGG - Intergenic
916963881 1:169915373-169915395 AGGCCCGGATGTGCAGGGGACGG + Intergenic
917012270 1:170488186-170488208 AGACCCTGGGTTGAAGTGGGAGG + Intergenic
917141766 1:171842011-171842033 AGGCGGGGGGTGGCAGGGGACGG - Intronic
919737875 1:200964904-200964926 GGAGCCGGGGTAGGAGGGGATGG + Intergenic
919849992 1:201666149-201666171 AGGCCCAGTGTTGCTGGGGAAGG - Intronic
922724730 1:227917566-227917588 AGACGCGAGGTGGCAGGAGAGGG + Intergenic
922817851 1:228463795-228463817 AGGTCCGGGGTTGGAGGTGAGGG - Intergenic
922998340 1:229984698-229984720 AGACCTGGGGGAGCAGGGAAGGG - Intergenic
923460504 1:234205892-234205914 GGACCTGGGGGTGCAGGGGGTGG + Intronic
923506385 1:234609582-234609604 AGACGCGGGGTTGGGGGGGGAGG - Intergenic
1063074115 10:2697613-2697635 AGAACCAGGGTTGCTGGCGATGG + Intergenic
1066010245 10:31188155-31188177 AGGACCGGGGCTGCAGGTGACGG - Intergenic
1067135851 10:43606636-43606658 CGAGCCGGGGTGGGAGGGGAAGG + Intronic
1068783113 10:60943479-60943501 AGACACGGGGTTGCGGGGGAGGG + Intronic
1069962768 10:72088091-72088113 AGACCCGGGGTTGCGGGTTCGGG - Intronic
1072845465 10:98825599-98825621 AGCCCCGGGGTTGGGGGGGCGGG + Intronic
1073068772 10:100780373-100780395 AGGCCCGGGGTTTGAGGGGCTGG + Intronic
1073071028 10:100793345-100793367 AGACCCGGGGAGGAAGGAGAGGG - Intronic
1074204180 10:111267816-111267838 AGACTGCAGGTTGCAGGGGAAGG - Intergenic
1075617245 10:123899639-123899661 AGACCCTGGGAGGAAGGGGAAGG + Intronic
1076395396 10:130135040-130135062 AGGCTCTGGGATGCAGGGGAGGG + Intergenic
1076841727 10:133049173-133049195 AGCCCCCGGGTTACAGGAGACGG - Intergenic
1076885076 10:133258462-133258484 CCACCCGGGGTGGCAGGGCAGGG + Intergenic
1077020105 11:413617-413639 AGAGGAGGGTTTGCAGGGGAGGG - Intronic
1077351848 11:2096762-2096784 AGCCTTGGGGTTGCAGGGGTAGG - Intergenic
1078174042 11:8955324-8955346 GGACCAGGGGTGGTAGGGGATGG + Intronic
1080580770 11:33641949-33641971 AGACCCTGGGTTGGGGGTGATGG - Intronic
1080606547 11:33869309-33869331 ACACCGGGGGTGGCAGGGGCAGG + Intronic
1081527167 11:43935039-43935061 TGTGCCGGGGCTGCAGGGGAAGG - Intronic
1081871678 11:46385561-46385583 GGGCCCGCGGCTGCAGGGGAGGG + Exonic
1084044378 11:66560315-66560337 GGTGCCAGGGTTGCAGGGGATGG + Intronic
1085387961 11:76167988-76168010 AGCCCTGGGGTGGGAGGGGAGGG - Intergenic
1085415964 11:76319080-76319102 AGACCTGGGGGTGGCGGGGAGGG - Intergenic
1086010174 11:82093268-82093290 AGATCAGGGGTTGCCAGGGAAGG + Intergenic
1087188630 11:95230479-95230501 CGACCCGGGGTAGCAAGGTAGGG + Intronic
1089125447 11:116173271-116173293 ATACCTGGGGATGCAGAGGAGGG - Intergenic
1089338972 11:117744888-117744910 AGGCCCTGGCATGCAGGGGAAGG - Intronic
1089631352 11:119786535-119786557 AGACCAGGGGCTGCAAGGGAAGG + Intergenic
1089744602 11:120607907-120607929 AGACCCTGGATTCCAGGGGGTGG + Intronic
1091357704 11:134950447-134950469 AGGCCTGGGGTTTCAGGTGAGGG + Intergenic
1092564399 12:9648918-9648940 AGAGCCGGCTTTGCAGGTGATGG + Intergenic
1096979170 12:55718607-55718629 TGACCCAGGGTTCCTGGGGAGGG + Intronic
1097222466 12:57459353-57459375 AGAGCCGGGGTTCTAGGGAAAGG + Intergenic
1100324628 12:93529476-93529498 AGACCAGGGGTCGGGGGGGATGG - Intergenic
1100815726 12:98385406-98385428 AGACACCAAGTTGCAGGGGAGGG - Intergenic
1101365857 12:104069846-104069868 ATATCGGGGGTTGCAGGGCAAGG - Intronic
1102702580 12:114852396-114852418 AGACCAGGGTGTGCAGAGGAAGG - Intergenic
1102969885 12:117158009-117158031 AGACCCGGGGCAGCACGGGGCGG - Exonic
1103600640 12:122052506-122052528 GGACCCAGTGTTGCTGGGGAAGG - Intronic
1104021387 12:124994389-124994411 AAACCCGGGGTAGCTGGGGAGGG - Intronic
1104729686 12:131098024-131098046 TGGCGCGGGGGTGCAGGGGAGGG - Intronic
1104842259 12:131830736-131830758 GGAGCCGGGGCTGGAGGGGAGGG + Intronic
1105844271 13:24281238-24281260 AGAGACGGGGTTGGAGGGGGAGG - Intronic
1106355198 13:28975500-28975522 AGGCAGGGGGCTGCAGGGGAGGG - Intronic
1108507023 13:51121352-51121374 ATACCTGGGGTTGCAAGGGTGGG + Intergenic
1112564892 13:100544815-100544837 AGACATGGGGATGCAGGGGATGG - Intronic
1113586254 13:111468130-111468152 GGACCAGGGGTGGCATGGGAAGG + Intergenic
1113780446 13:112973766-112973788 AGACCCGTGGCTCCAGGGGCTGG + Intronic
1114458402 14:22872027-22872049 AGACCCGGGGCTTCAGGAGCCGG + Exonic
1114613621 14:24057132-24057154 GGAAGAGGGGTTGCAGGGGAAGG - Intronic
1117207892 14:53463425-53463447 AGGCGAGGGGTAGCAGGGGATGG + Intergenic
1118374490 14:65164967-65164989 AGACCCTGGGTTGGAGGAGGTGG - Intergenic
1119559293 14:75577977-75577999 AGACCCTAGGGTGCGGGGGAGGG - Intergenic
1120190470 14:81435905-81435927 CAACCCGGGGTTTCAGGCGAGGG + Intronic
1121414232 14:93767914-93767936 AGATCAGTGGCTGCAGGGGATGG + Intronic
1121839510 14:97121002-97121024 AGACCTGGGGTTGCAAGGTCAGG + Intergenic
1122083082 14:99280412-99280434 AGGCCAGGGTTTGCAGGGCAGGG - Intergenic
1122877025 14:104672259-104672281 AGACCTGGGGGTACAGGGGCTGG + Intergenic
1123420104 15:20124507-20124529 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1123445758 15:20329025-20329047 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
1123529327 15:21131043-21131065 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1125926022 15:43563884-43563906 AGACCCTGAGTTGCAGGGATGGG + Intronic
1125939166 15:43663435-43663457 AGACCCTGAGTTGCAGGGATGGG + Intronic
1126730025 15:51673186-51673208 AGAAGGGGGATTGCAGGGGAAGG + Intergenic
1126740838 15:51774748-51774770 AGCCCTGGGGTTGCTGTGGAGGG + Intronic
1127732462 15:61813472-61813494 ACACCAGGGGTTCCAGGAGAAGG + Intergenic
1128113892 15:65093623-65093645 AGCCCTGGGGTCGGAGGGGAAGG - Intronic
1129220924 15:74131243-74131265 AGACCCGGCGTGGCAGAGCAGGG - Exonic
1129537734 15:76327882-76327904 GGACCCTGGGTTGGAGTGGAGGG - Intergenic
1132591023 16:726519-726541 AGACCGGTGGTTGCTGAGGAGGG + Intronic
1132611895 16:821242-821264 AGGCCCTGGGAGGCAGGGGAGGG + Intergenic
1132709289 16:1259328-1259350 AGATCAGGGGCTGCAAGGGAGGG + Intergenic
1132767703 16:1542798-1542820 AGGCCCGGCCTTGCAGGCGAGGG + Intronic
1133331021 16:4974067-4974089 AGGACTGGGGTGGCAGGGGAGGG + Intronic
1135045277 16:19150194-19150216 AGGCTTGGGTTTGCAGGGGAGGG + Intronic
1136280282 16:29204510-29204532 AGAGCCGTGGTTGCCGGGGCTGG - Intergenic
1136720987 16:32319583-32319605 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1136839372 16:33525869-33525891 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1137548094 16:49417955-49417977 AACCCAGGGGTGGCAGGGGAAGG + Intergenic
1138280393 16:55768514-55768536 AGACCCAGGGCTTCAGGGAAAGG + Intergenic
1138288092 16:55825118-55825140 AGACCTGGGGCTTCAGGGAAAGG - Intronic
1139937721 16:70583504-70583526 AGCCCCTGAGATGCAGGGGAAGG - Intronic
1140152578 16:72385427-72385449 AGTTCCGGGGTAGCAGGGAATGG - Intergenic
1140811805 16:78585758-78585780 TGCCTTGGGGTTGCAGGGGAAGG - Intronic
1141500219 16:84438961-84438983 AGAGCGGGGTCTGCAGGGGAGGG + Intronic
1141662911 16:85451269-85451291 AGACCCGTGGGTGCAGGGGCTGG - Intergenic
1141667893 16:85475235-85475257 AAACCAGGGGCAGCAGGGGAGGG + Intergenic
1141757670 16:86003121-86003143 AGACCCGTGATTGCCGGGGCTGG - Intergenic
1142084642 16:88170452-88170474 AGAGCCGTGGTTGCTGGGGCTGG - Intergenic
1142226102 16:88878345-88878367 AGCCCCGGGGTGGGAGGAGATGG - Intronic
1203005445 16_KI270728v1_random:198187-198209 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
1203136995 16_KI270728v1_random:1734308-1734330 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
1203149537 16_KI270728v1_random:1826154-1826176 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1142748393 17:1972534-1972556 AGAGAGGGCGTTGCAGGGGAGGG - Intronic
1142851790 17:2707981-2708003 AGAGCCGGGGCTGCTGGGAAGGG - Intronic
1144563920 17:16344308-16344330 AGAGCTGGTGTTGCTGGGGATGG - Intronic
1145279252 17:21456065-21456087 AGACCGGGGGGTGCTGGGGCAGG + Intergenic
1145863957 17:28228268-28228290 AGACCAGGGGCTGCTGTGGAAGG + Intergenic
1146283754 17:31560732-31560754 AAACCCGAGGTTTCAGGGGTTGG - Intergenic
1146546876 17:33747778-33747800 AGACCTGGGGAAGAAGGGGAGGG - Intronic
1148115173 17:45171255-45171277 GGACCCAGGGTTCCAGGGGCAGG - Intergenic
1148559426 17:48597457-48597479 AGAGCCGGGGTTCCAGGACAGGG - Intronic
1148830113 17:50425848-50425870 TGACCCGAGGGGGCAGGGGATGG + Intergenic
1149915169 17:60601353-60601375 TGACCCGGGATTGCTGGGGTTGG + Intronic
1151057469 17:71049840-71049862 AGGTCTGGGGTTGGAGGGGAAGG - Intergenic
1151671541 17:75574029-75574051 AGACCTGGGGCTGGACGGGAGGG + Intronic
1152096973 17:78278227-78278249 GGAGGCGGGGTTGCAGGTGAGGG - Intergenic
1152568458 17:81110846-81110868 GGACTCGGGGGTGCAGAGGAGGG - Intronic
1153667523 18:7379488-7379510 AGACCAGGGGTACCAGGGGTGGG - Intergenic
1156248577 18:35328458-35328480 AGATCAGTGGTTGCAGGGGTTGG - Intergenic
1158633880 18:59139689-59139711 AGACCCGGGGCTCCTAGGGAGGG - Exonic
1158874710 18:61722486-61722508 AGAGCATGGGGTGCAGGGGAGGG - Intergenic
1160246767 18:77165621-77165643 AGATCAGGGGGTGAAGGGGAGGG + Intergenic
1160804937 19:988489-988511 AAACCCAGGGTGGCTGGGGAGGG - Intronic
1161078938 19:2300846-2300868 AGACCGCGGTTTGCAGGGGCTGG - Intronic
1163015348 19:14451128-14451150 AGGCCCAGGGCTGCAGGGGTGGG - Intronic
1163509165 19:17725206-17725228 AGAGCTGGGGAAGCAGGGGATGG - Intronic
1163628010 19:18402042-18402064 AGACCCGAGGCTGCAGGTGGTGG + Intergenic
1163794510 19:19329392-19329414 AGAACCGGGGTGGGAGAGGAAGG - Intronic
1164121066 19:22265881-22265903 AGCCCCTGGGGTGCAGGGGAGGG + Intergenic
1164178868 19:22802299-22802321 AGCCCCTGGGGTGTAGGGGAGGG - Intergenic
1165101343 19:33440374-33440396 AGCCCTGGGGTTGGAGTGGATGG - Intronic
1165389730 19:35531494-35531516 TACCCCGGGGCTGCAGGGGAGGG + Intergenic
1165958919 19:39518700-39518722 GGTCATGGGGTTGCAGGGGAGGG - Intronic
1166776429 19:45315639-45315661 AGACCTGGGCTTGCTGGAGAGGG - Intronic
1166996114 19:46720403-46720425 AGCCCTGGGCATGCAGGGGAGGG - Intronic
1167272199 19:48511816-48511838 GGAGCCGGGGTTGCTGGGGTGGG + Intronic
1167758215 19:51426539-51426561 GGACCCGGGGATGCAAGGGTTGG + Intergenic
1167887770 19:52516191-52516213 AGACCAGGGGTGGGAGGGCATGG - Intergenic
1168121294 19:54253962-54253984 AGACCAGGGGAGGCAGGGGTGGG - Intronic
1168287046 19:55340285-55340307 AGACCTGGGGGTGCAGGGAGAGG - Intronic
1202689636 1_KI270712v1_random:77836-77858 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1202696784 1_KI270712v1_random:131923-131945 AGTCCCGGGGTTGCGGGGCTGGG - Intergenic
925669365 2:6294485-6294507 AGTCCTGGGCCTGCAGGGGAAGG - Intergenic
926131880 2:10308149-10308171 AGAGTTGGGGGTGCAGGGGAGGG + Intronic
927495667 2:23550043-23550065 ACACCCTGGGGGGCAGGGGAGGG - Intronic
927840950 2:26443468-26443490 TTACCCAGGCTTGCAGGGGAGGG - Intronic
928312951 2:30225433-30225455 ATACCTGGGGCGGCAGGGGAGGG - Intergenic
929809283 2:45175330-45175352 TGACACAGGGTTGTAGGGGAAGG - Intergenic
930676653 2:54208431-54208453 GGAGCCGGGGGTGCAGGGGGTGG + Intronic
931135825 2:59399472-59399494 AGACATGGGGTTGGATGGGAGGG - Intergenic
931670459 2:64642710-64642732 AGACCCTGGGTTGGGGGGGCAGG + Intronic
931863099 2:66378007-66378029 AGGCCGGGGGTTGCGGGGGCGGG - Intergenic
932440740 2:71733119-71733141 AGCCCAGGGGTTGGACGGGAAGG - Intergenic
932566450 2:72914299-72914321 AGGCTCCGGGTTGCAGGAGATGG + Intergenic
933956783 2:87378186-87378208 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
934240928 2:90270213-90270235 GGCCCAGGGGTTGCAGGGGAGGG - Intergenic
934272267 2:91546546-91546568 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
934277937 2:91588937-91588959 AGTCCCGGGGTTGCGGGGCTGGG - Intergenic
934939565 2:98490529-98490551 GAACCCGGGGTTTCAGGTGAGGG + Intronic
935369765 2:102333015-102333037 GGATACGGGGTTGGAGGGGAGGG + Intronic
936148306 2:109996456-109996478 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
936196371 2:110374912-110374934 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
938712857 2:133990445-133990467 AGACCCTAGGTAGCAGGGGGAGG + Intergenic
945182356 2:207104970-207104992 AGACCATGGGTTCTAGGGGAGGG - Intronic
946134350 2:217633546-217633568 AGCCCAGGGGTTGCTGGTGAGGG - Intronic
946472056 2:219970042-219970064 AGATCAGTGGTCGCAGGGGATGG + Intergenic
946710170 2:222497362-222497384 AGACCCGGGGAGGCAGAGGCAGG - Intronic
947275568 2:228387914-228387936 AGACACAGGGTTGGAGGGGGAGG - Intergenic
947670065 2:231930173-231930195 GGCCCCAGGGCTGCAGGGGAGGG + Intergenic
948436622 2:237958088-237958110 AGAGCTGTGGCTGCAGGGGAAGG + Intergenic
948578725 2:238970223-238970245 AGCCCTTGGGTTGCAGGGGCAGG - Intergenic
948666080 2:239535698-239535720 TGACCTAGGGATGCAGGGGAAGG - Intergenic
948761906 2:240197497-240197519 TGACCTGGGGCTGCAGGGCATGG - Intergenic
948768818 2:240236922-240236944 AGGCACAGGGGTGCAGGGGAGGG - Intergenic
948880117 2:240852368-240852390 AGACCCCCGGTAGGAGGGGAGGG - Intergenic
949026203 2:241767603-241767625 GGTCTCGGGGTTGCTGGGGAGGG + Intronic
1168772873 20:427398-427420 AGACCCCAGATTGCAAGGGATGG + Exonic
1171816159 20:29787627-29787649 AGAGCCGCTGGTGCAGGGGAGGG + Intergenic
1172039083 20:32031262-32031284 AGCCCCGGGGCTCCAGGGGCGGG + Exonic
1172200708 20:33124221-33124243 AGACCCCTGGGGGCAGGGGAGGG + Intergenic
1172846191 20:37931129-37931151 ATACCTGGGGTCCCAGGGGAGGG + Intronic
1172889381 20:38253149-38253171 TGACCTTGGGCTGCAGGGGAGGG - Intronic
1173007941 20:39155471-39155493 AGGCTCTGGGTTGCAGGGGTAGG + Intergenic
1175439484 20:58981000-58981022 AGAGCCGGCGCCGCAGGGGAGGG + Intergenic
1175571946 20:60030064-60030086 AAACCAGGGGTTGTGGGGGAAGG - Intronic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1176053074 20:63130798-63130820 AGACCCAGGGCTGCAGGGGGAGG + Intergenic
1176192076 20:63816320-63816342 AGACACGGGGTGGGTGGGGAGGG - Intronic
1176358103 21:5969548-5969570 AGGCCAAGGGTGGCAGGGGAAGG + Intergenic
1178824634 21:36004971-36004993 AGACAGGGGGAGGCAGGGGAAGG + Intergenic
1179156978 21:38859290-38859312 AGAGGTGGGGTTGCAGGGAAGGG + Intergenic
1179226050 21:39454492-39454514 AGACCCTGGGGAGCAGGAGAGGG + Intronic
1179469672 21:41602144-41602166 GGACAAGGGGTTGAAGGGGAGGG + Intergenic
1179606200 21:42517072-42517094 AGGCCCGGGACTGCAGGGCAAGG - Intronic
1179765415 21:43569003-43569025 AGGCCAAGGGTGGCAGGGGAAGG - Intronic
1179921658 21:44510695-44510717 AGAGCCTGGGCTGCAGGGGAGGG + Intronic
1179972551 21:44844355-44844377 AGGTCAGGGGCTGCAGGGGAGGG - Intergenic
1180551783 22:16546727-16546749 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
1181352223 22:22267196-22267218 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1181472926 22:23152002-23152024 AGCCCCGGGGGTGCATAGGAGGG + Intronic
1181757110 22:25031866-25031888 AGACCCTGGGTTGCTGAGTATGG + Intronic
1183634445 22:39052495-39052517 AGACCTGGGCTTGGAGGGGAGGG + Intronic
1184244457 22:43228869-43228891 AGACAAGGGGTAGCAGGGAACGG - Intronic
1184249781 22:43253507-43253529 AGAGGTGGGGGTGCAGGGGAGGG + Intronic
1184573160 22:45339902-45339924 AGAGCCGGGGCTGCAGGTGCAGG - Intronic
1184661311 22:45966896-45966918 AGGGCCGGGGATGCTGGGGAGGG - Intronic
1184890552 22:47376379-47376401 AGTCCCTGGGCTGCAGGGCAGGG - Intergenic
1185129079 22:49027434-49027456 AGGTCAGGGGATGCAGGGGATGG - Intergenic
950088152 3:10276002-10276024 CGACCTGGGGTGGCAGGGGCAGG - Intronic
950101620 3:10360261-10360283 AGCCCTGAGGGTGCAGGGGATGG - Intronic
950521428 3:13500187-13500209 ATCCCAGGGGCTGCAGGGGAGGG + Intronic
950548626 3:13653550-13653572 AATCCAGGGGTTGCAGCGGAAGG + Intergenic
950702721 3:14761321-14761343 AGGCCTGGGGTGGCTGGGGAAGG - Intronic
952376738 3:32773988-32774010 TGACCTGGGGGTGAAGGGGAGGG + Intergenic
953221368 3:40974649-40974671 AGATCAAGGGTTGCAGGGGTGGG - Intergenic
953361930 3:42304985-42305007 AGATCAGGGGTTGCATGGGGAGG - Intergenic
954791402 3:53135984-53136006 AGACCCTGGGTCCCAGGGGCTGG - Intergenic
954840562 3:53508011-53508033 AAACCCGAGGGTGCAGGGCAGGG - Intronic
955803244 3:62707317-62707339 AGACCCGGGGTTGCAGGGGATGG - Intronic
957878729 3:86183278-86183300 AGACCCTGGGCTGAAGGAGAAGG + Intergenic
959111114 3:102123751-102123773 AGAGCCTGGGTTCCTGGGGATGG + Intronic
961306137 3:125959888-125959910 AGAGCCGGGGCTGAAGGGGCCGG - Intergenic
961795000 3:129402993-129403015 AGGCTCAGGGTTGGAGGGGAAGG - Intronic
961823461 3:129586849-129586871 AGTCACGGGCGTGCAGGGGAGGG + Intronic
964251561 3:154723888-154723910 AGTCCTGGGGTGGCAGGGCATGG - Intergenic
965024138 3:163277043-163277065 AGACCAGTGGTTTCAGGAGACGG - Intergenic
966471929 3:180299257-180299279 AGATCAAGGGTTGCAGGTGAAGG - Intergenic
967880351 3:194297242-194297264 GGGCCCGGGGCTGGAGGGGAGGG - Intergenic
967966033 3:194960874-194960896 AGACCCAGGGTTTCTGAGGATGG + Intergenic
968532251 4:1098667-1098689 AGAACCAGGGTTGCAGGTCAAGG - Intronic
968881192 4:3301033-3301055 AGACCCCGTGTTACAGAGGAGGG - Intronic
968881202 4:3301067-3301089 AGACCCCGTGTTACAGAGGAGGG - Intronic
968881210 4:3301100-3301122 AGACCCCGTGTTACAGAGGAGGG - Intronic
968881219 4:3301133-3301155 AGACCCCGTGTTACAGAGGAGGG - Intronic
968881229 4:3301167-3301189 AGACCCCGTGTTACAGAGGAGGG - Intronic
969120894 4:4910333-4910355 AGGCCTGTGGTGGCAGGGGATGG - Intergenic
969330994 4:6473298-6473320 AGCCCTGGGTTTGGAGGGGAGGG - Intronic
969371031 4:6731804-6731826 AGACCCAGTGAGGCAGGGGAGGG + Intergenic
973530390 4:51831875-51831897 GGCCCTGGAGTTGCAGGGGAAGG + Intergenic
975616433 4:76251881-76251903 AGACCCGCGCTTGCTGGGGCGGG + Intronic
977692657 4:99932965-99932987 AAAGCTGGGGGTGCAGGGGAGGG + Intronic
978576651 4:110196578-110196600 AGGCCAGGGGGTGCAGGGGTGGG - Intronic
983537970 4:168878155-168878177 AGACCGGGGGTGGCGGGGGCGGG - Intronic
985494667 5:197902-197924 AGACACGGGGCAGCAGGGGTGGG - Exonic
985587519 5:748628-748650 AGACCAGAGCTTGCTGGGGATGG + Intronic
985716877 5:1467778-1467800 AGCCCAGGGGTTGGAGCGGAAGG - Intronic
985816193 5:2130062-2130084 AGCCCCGGGGTTCCAAGTGATGG - Intergenic
986730081 5:10628855-10628877 AGACCTGGAGTTGGAAGGGATGG + Intronic
988191104 5:27935951-27935973 AGACCCGGGATTGTAGGTGTAGG + Intergenic
992558719 5:77929268-77929290 AGAGCCGGGGAGGCAGGGTAGGG + Intergenic
997021427 5:130007433-130007455 AGATCCTGGGTTGAAGGGGGAGG + Intronic
997065818 5:130557121-130557143 AGCTTGGGGGTTGCAGGGGAAGG - Intergenic
1000322097 5:160142557-160142579 AGATGGTGGGTTGCAGGGGAGGG + Intergenic
1000924690 5:167179577-167179599 GGAGCCGGGGTTGCGGGGGTGGG - Intergenic
1002491045 5:179577625-179577647 AAATCCGGGGCTGGAGGGGAGGG + Intronic
1002792135 6:444626-444648 AGACAAGGGCGTGCAGGGGAAGG - Intergenic
1003317903 6:5028008-5028030 AGAGACGGGGTTGAAGAGGAAGG + Intergenic
1004428965 6:15526348-15526370 AGACACGGGGGTGGAGAGGAGGG + Intronic
1004893870 6:20127828-20127850 AGACCCAGGGTTGCGGGTGGTGG - Intronic
1005465276 6:26106958-26106980 GGACCAGGGGGTGCAGGGGCTGG + Intergenic
1006011226 6:31044608-31044630 AGACCAGGGTTTACAGGGGATGG - Intergenic
1006392436 6:33766439-33766461 AGACCCCAGGTGGGAGGGGAAGG - Intergenic
1008541490 6:52550219-52550241 AGAGCTGTGGTTGAAGGGGAGGG - Intronic
1009472411 6:64043993-64044015 GGTCCAGGAGTTGCAGGGGAAGG - Intronic
1012336702 6:98068490-98068512 AGCCCTGGTGTTCCAGGGGATGG - Intergenic
1012582468 6:100885268-100885290 AGACTCGGTGTTGCAGGATAAGG - Intergenic
1014045220 6:116877167-116877189 GGACCCGGGGCCGCAGGGGCGGG - Intergenic
1016145899 6:140672973-140672995 AGACCTGGGGATGGAGGGGTGGG + Intergenic
1017700493 6:157064812-157064834 AGAGCCGGGGCTGAAGGGCAGGG - Intronic
1018770852 6:166970583-166970605 TGCCCCGGGTTTGCAGGGGTGGG + Intergenic
1018890565 6:167978482-167978504 ACACCCGGGGTGGCAGGGACCGG + Intergenic
1018916450 6:168135266-168135288 GGACTCGGGGATGCAGGGGTGGG + Intergenic
1019278036 7:186442-186464 GGACGCGGGGTGGCTGGGGAGGG - Intergenic
1019360426 7:601877-601899 TGACCCGGGGGGGCTGGGGAGGG + Intronic
1019479088 7:1258022-1258044 CGTCCCGGGGTTGCGGGGCAGGG - Intergenic
1020282058 7:6654739-6654761 AGACCCGGGGCCGCAGGGCGAGG - Exonic
1020690848 7:11353047-11353069 ACACCCAGGCTTCCAGGGGATGG - Intergenic
1022260549 7:28700322-28700344 ACCCCGGGGGTTCCAGGGGATGG - Intronic
1022305586 7:29143824-29143846 AGACCCTGGGGTGCAGGACAGGG - Intronic
1022409849 7:30131048-30131070 AGACCCCAGGTTCCAGGAGACGG - Intergenic
1023842610 7:44105601-44105623 AGAGCTGGGGTGGCAGGGGAGGG - Intronic
1024055828 7:45659347-45659369 AGAACTGGGTTTGCAGGGAATGG + Intronic
1024987965 7:55212277-55212299 AGCCACGGTGTGGCAGGGGAGGG + Intronic
1026977137 7:74505700-74505722 AGGGACGGGCTTGCAGGGGATGG + Intronic
1029370844 7:100149418-100149440 AGACTTGGGTTTGCAGGTGAAGG + Intronic
1029704136 7:102266989-102267011 AGAGCCGGTGCTGCAGGAGAGGG + Intronic
1030304301 7:108003224-108003246 AGAGCCGGGGCTGAAGGGGCGGG + Exonic
1030339464 7:108360417-108360439 TGACCCGGGGTTGCAGGGTGGGG + Intronic
1031329954 7:120452498-120452520 AGACACTGGGCTGAAGGGGAAGG + Intronic
1032477551 7:132222599-132222621 AGACTAGGGGTTGCAGGTGAAGG + Intronic
1033327189 7:140389554-140389576 AGAGCCGGCTTTGCAGGAGATGG - Intronic
1033447704 7:141436891-141436913 TGACCCGGGGGTGGAGGAGATGG + Intronic
1035372373 7:158387591-158387613 AGGCCCGGGGATGCAGCTGAAGG + Intronic
1037967175 8:23144311-23144333 AGACAGGGGACTGCAGGGGACGG - Intronic
1039454626 8:37698472-37698494 CGACCCGGGGCTGCCGGGGGCGG - Exonic
1040872333 8:52113459-52113481 ACTGCTGGGGTTGCAGGGGATGG + Intronic
1043443477 8:80297532-80297554 TGATCTAGGGTTGCAGGGGAGGG + Intergenic
1045510450 8:102808701-102808723 AGGCCCAGCGTTGCAGAGGATGG - Intergenic
1045654931 8:104376951-104376973 AGACCGGGGGTTGGGAGGGATGG + Intronic
1048016370 8:130501089-130501111 GGACTCGGGGCTTCAGGGGAAGG + Intergenic
1048571734 8:135662484-135662506 AGAGCAGGTGTTGCAAGGGAAGG + Intergenic
1049060621 8:140273561-140273583 AGGCCTGGGGTGGGAGGGGAAGG - Intronic
1052346092 9:27411250-27411272 AGTCCTGGGGTTGGAGGGAAGGG + Intronic
1056554556 9:87677813-87677835 AGACCCAGGGCTGCTGCGGAAGG + Intronic
1057305659 9:93910699-93910721 AGAGGCAGGGTTGCTGGGGAGGG + Intergenic
1061043151 9:128151136-128151158 AGCCCTGGGGTGCCAGGGGATGG + Intronic
1062436810 9:136550023-136550045 AGACCGAGGGGTGCAGGGCATGG - Intergenic
1062473624 9:136717353-136717375 ATACCAGGGGCTGCAGGGGCCGG - Intronic
1062520166 9:136954460-136954482 AGACCCGGGGTGGGAGGAGGTGG - Intronic
1062520219 9:136954571-136954593 AGACCCGGGGTGGGAGGAGGTGG - Intronic
1062531042 9:137000520-137000542 GGAGCAGGGGCTGCAGGGGACGG - Intergenic
1062586173 9:137251011-137251033 AGACCCCAGGGTGCAGGAGAGGG + Intergenic
1185485417 X:478160-478182 AGTCCCTGGGGTGCAGGAGAGGG + Intergenic
1187762030 X:22597980-22598002 AGATCAGTGTTTGCAGGGGAGGG - Intergenic
1188003428 X:25002350-25002372 GGACCCGGGGTTGGAGAGGAGGG + Intergenic
1189325388 X:40108306-40108328 AGAGCGGGGGTCGCCGGGGAAGG - Intronic
1190324504 X:49198846-49198868 AGTGCGGGGGTTGTAGGGGATGG - Intronic
1192203577 X:69082175-69082197 AGACCTGGGAGGGCAGGGGAAGG - Intergenic
1192325920 X:70132015-70132037 AAAGCAGGGGTTGCAAGGGAAGG + Intergenic
1195323208 X:103737722-103737744 ATGCCCAGGGTTGCAAGGGAAGG - Intergenic
1200049199 X:153419784-153419806 AGACCTGGGGTTCCAGGGAGGGG + Intronic
1200234806 X:154463154-154463176 AGGTCAGGGGATGCAGGGGAGGG - Intronic