ID: 955803800

View in Genome Browser
Species Human (GRCh38)
Location 3:62713222-62713244
Sequence CAGGAGAAGGAGAAATGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 1, 2: 3, 3: 35, 4: 434}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955803800_955803807 3 Left 955803800 3:62713222-62713244 CCAGACCATTTCTCCTTCTCCTG 0: 1
1: 1
2: 3
3: 35
4: 434
Right 955803807 3:62713248-62713270 AAGGACTACCATTTCTTTCAGGG 0: 1
1: 0
2: 0
3: 21
4: 221
955803800_955803809 5 Left 955803800 3:62713222-62713244 CCAGACCATTTCTCCTTCTCCTG 0: 1
1: 1
2: 3
3: 35
4: 434
Right 955803809 3:62713250-62713272 GGACTACCATTTCTTTCAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 92
955803800_955803806 2 Left 955803800 3:62713222-62713244 CCAGACCATTTCTCCTTCTCCTG 0: 1
1: 1
2: 3
3: 35
4: 434
Right 955803806 3:62713247-62713269 AAAGGACTACCATTTCTTTCAGG 0: 1
1: 0
2: 1
3: 15
4: 263
955803800_955803808 4 Left 955803800 3:62713222-62713244 CCAGACCATTTCTCCTTCTCCTG 0: 1
1: 1
2: 3
3: 35
4: 434
Right 955803808 3:62713249-62713271 AGGACTACCATTTCTTTCAGGGG 0: 1
1: 0
2: 2
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955803800 Original CRISPR CAGGAGAAGGAGAAATGGTC TGG (reversed) Intronic
900142554 1:1144775-1144797 GAGGAGAAGGAGGAATCGCCCGG - Intergenic
900505031 1:3025627-3025649 AAGGAGAAGGAGCCATGGTCTGG - Intergenic
900917204 1:5647149-5647171 CAGGAGAAGGATAAATGCAAAGG + Intergenic
902722340 1:18312281-18312303 CAGGAGCAGGGGTAATTGTCAGG + Intronic
903019026 1:20380714-20380736 AAGGAGGAGGCGAAATGGCCAGG - Intergenic
903431442 1:23304239-23304261 CAAGTGAAGGAGAAGTGGTGAGG - Intronic
904131800 1:28281044-28281066 CAGGGGAAGGAGGAAGGGTGTGG - Exonic
904348510 1:29889849-29889871 AAGGAGCAGGAGAAATGGGAAGG + Intergenic
904412361 1:30332183-30332205 CAGGTGCAGGAGGAATGTTCTGG - Intergenic
905006546 1:34714454-34714476 GGGCAGAAGGAGAAATGGTGGGG - Intronic
905403587 1:37719214-37719236 CAGGAGAAGCAGAAGTGACCAGG + Intronic
905653007 1:39668952-39668974 AAGGAGCAGGTGAAATGGGCTGG + Intronic
907755192 1:57304192-57304214 CAGGAGCAGGAGAGAAGGTGGGG + Intronic
907755661 1:57307894-57307916 ATGGAGAAGGAGACCTGGTCTGG - Intronic
908393233 1:63702473-63702495 CTGGCGATGGAGAAATGGTTAGG + Intergenic
908784641 1:67722830-67722852 CAGGAGCAGGCAACATGGTCAGG + Intronic
909326370 1:74355739-74355761 AAGGAGAAGGAAAAATGTACAGG + Intronic
909369725 1:74870036-74870058 CAGCAGAAGGTGAAATGGTTGGG - Intergenic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910944655 1:92577275-92577297 AGGGAGGAGGAGAAATGGGCAGG - Intronic
911104778 1:94121134-94121156 CAGGAGAAGGACACAGCGTCCGG - Intergenic
912114514 1:106388638-106388660 AAGGAGAAGGAGAAGTAGTAGGG + Intergenic
912653089 1:111458548-111458570 CAGCTGAAGTAGAATTGGTCGGG + Intronic
912679128 1:111717610-111717632 AAGGAGAATGAGGAATGGGCAGG + Intronic
912708127 1:111929886-111929908 CAGGAGACAGAGAAACGCTCTGG + Intronic
913099635 1:115551169-115551191 CCGGAGATGGAGACATGATCAGG - Intergenic
913451259 1:118994166-118994188 CAGGACAGTGAGAAATGGTGGGG + Intergenic
913538063 1:119793334-119793356 GAGTAGAAGGAGAACTGGTTAGG + Intergenic
914447734 1:147764105-147764127 CACGAGAAGGAGCACTGGGCCGG - Intronic
915874312 1:159596069-159596091 CAGGAGGAGGAAAAATCTTCTGG - Intergenic
916583653 1:166130805-166130827 CAGGAGAAAGAGCACAGGTCTGG - Intronic
916693917 1:167218148-167218170 CAGGAGCAAGAGAAAGGGTAGGG - Intergenic
916972987 1:170044071-170044093 CAGGAGAGGGTAAAATGGTCTGG + Intronic
917572190 1:176279222-176279244 CAGGAGCAGGAGAAATGTGTAGG + Intergenic
919710429 1:200722018-200722040 AAGGAGAAGGTGAAATAGGCTGG + Intergenic
919747268 1:201016747-201016769 CAGGAGAGGGACAAATGGGAGGG - Intronic
920729379 1:208468470-208468492 CAGGAGAAGGGCACATGGTTCGG - Intergenic
921109551 1:212020662-212020684 CAGCAGAAGATGGAATGGTCGGG + Intronic
922798587 1:228353568-228353590 CAGGAGAAGGAGCAAGTGTCAGG + Intronic
922898593 1:229119273-229119295 CAGGAGAAGGTCACGTGGTCAGG + Intergenic
922975416 1:229779728-229779750 AAGGAGAAGGTGAAGTGGTGGGG + Intergenic
923093972 1:230760423-230760445 CAGGAGAAGGTGACACTGTCTGG - Intronic
1063216289 10:3928976-3928998 CAGGAGAAGGAGAAAGGGAGGGG + Intergenic
1063248404 10:4248108-4248130 CAGGAGAAGGAGTTATGCACGGG - Intergenic
1063973450 10:11397223-11397245 CTGGATAAGGACAAATGGGCAGG + Intergenic
1065468761 10:26054608-26054630 CTGGAGAAGGGGAAATTATCCGG + Intronic
1065874921 10:29989213-29989235 CAAGAAAAGGAAAAATGGCCGGG - Intergenic
1066235282 10:33479685-33479707 CCAGAGAAGAAGAACTGGTCAGG + Intergenic
1067157018 10:43790716-43790738 CTGGGGAAGGGGGAATGGTCAGG + Intergenic
1067169045 10:43890827-43890849 GAGGAGAAGGAGAAATAGAAAGG - Intergenic
1067587642 10:47485738-47485760 CATGAGAAGGAGAGAGGGCCAGG + Intergenic
1067798796 10:49342213-49342235 CAGGAGAAGGAGCAATAGAAAGG + Intergenic
1068368746 10:56086615-56086637 CAAAAGGAGGAAAAATGGTCAGG + Intergenic
1069999305 10:72364485-72364507 AAGGAGGAGGAGACAGGGTCTGG - Intergenic
1070617074 10:77977433-77977455 CAGGACAAGGAGTCAAGGTCAGG + Exonic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG + Intronic
1072229613 10:93403247-93403269 GAGGAGGAGGAGAACTGGACAGG - Intronic
1072233988 10:93437795-93437817 CAGGAGAGGGAGAAGTGCTGGGG - Intronic
1072527874 10:96289926-96289948 CAGGGGAAGGAAAAATGTCCAGG - Intergenic
1073028811 10:100508479-100508501 CAGAAGAAAGAGAAAAGGCCAGG + Intronic
1073063434 10:100745358-100745380 CAGGGGAGGGAGAAATGGGAGGG - Intronic
1074185784 10:111098523-111098545 CAGGAGAAGGAGAGAGGATGAGG - Intergenic
1074306742 10:112286143-112286165 CAGGAGAAGGAGTAGTTGACAGG - Exonic
1074491238 10:113941532-113941554 AAGAAGCAGGAGAAATGGGCTGG - Intergenic
1076729596 10:132431784-132431806 CTGGAGAAGGAGAAATATTCTGG + Intergenic
1076954195 10:133686138-133686160 CAGGAGATGTAAAAATTGTCTGG - Intergenic
1076961103 10:133762327-133762349 CAGGAGATGTAAAAATTGTCTGG - Intergenic
1078520272 11:12057423-12057445 CAGGAGAAAGAGAAAAGGGGAGG - Intergenic
1078568216 11:12435305-12435327 CAGGAGAAGGGGAAAAGGATGGG - Intronic
1079092425 11:17490449-17490471 CTGGGGCTGGAGAAATGGTCTGG + Intergenic
1079262006 11:18891499-18891521 CAGAAGAAGGAGGAAAGGTAAGG - Intergenic
1079278893 11:19070463-19070485 CAGGAGAAGAAGGAGTGCTCTGG + Intergenic
1080040238 11:27752553-27752575 GAGGATAAGGAGTAATGGTATGG + Intergenic
1080062747 11:27974314-27974336 GAGGAGTAGGACAAAAGGTCAGG - Intergenic
1080801462 11:35614024-35614046 CAGGAGATCCAGAAAAGGTCAGG + Intergenic
1080936721 11:36871262-36871284 CAGGAGAGGGAGAGATGGAGGGG + Intergenic
1082193874 11:49278585-49278607 CAGGAGAGAGAGATATGGGCAGG + Intergenic
1082829702 11:57606681-57606703 AAGGAGAAGGAGAAAAGATAGGG - Intronic
1083101264 11:60308676-60308698 CAGGAGAAGGAAAAAGGGAGGGG - Exonic
1083392540 11:62365130-62365152 CAGGAGTGGGAGAAATGGGAAGG + Intronic
1083549749 11:63578423-63578445 CAGGAAATGGAGAAAAGATCAGG + Intronic
1084195369 11:67521525-67521547 CAGGAAAGGGACAAATGGGCCGG - Intronic
1084412304 11:69011955-69011977 CAGGACAAGGACAAATGCACAGG - Intronic
1084625636 11:70304285-70304307 CAGCAGAAGGAGAGATGCACAGG - Intronic
1084705935 11:70815964-70815986 CAGGGGAAGCAGAGATGGCCAGG - Intronic
1085210978 11:74778033-74778055 CAGGAGAAAGAGAACAGGGCTGG - Intronic
1085708657 11:78809661-78809683 AAGGAGTAGGAGCAATGGTCAGG + Intronic
1085928786 11:81055735-81055757 CAGGAGCAGGGGAAAAGGACAGG - Intergenic
1086165472 11:83772741-83772763 CAGGAGAATGTGTAATGGCCTGG - Intronic
1087149856 11:94849566-94849588 CAGGAAAAGGGGAAATTGTGGGG + Intronic
1087917258 11:103825368-103825390 CTGCAGAAGGAGAACAGGTCAGG + Intergenic
1088087764 11:106002088-106002110 AATGAGAAGGTGAAATGGGCCGG + Intronic
1088423454 11:109674342-109674364 CAGGAGAAGCAAAATTGCTCTGG - Intergenic
1089208571 11:116785211-116785233 CTGGAGTGGGAGAAATGCTCAGG + Intronic
1089299148 11:117487986-117488008 CAGGAGAGGGAAAGACGGTCTGG + Intronic
1089413003 11:118262855-118262877 AAGGGAAAGGAGAAATGGACTGG + Intronic
1089625500 11:119748445-119748467 CAAGAGAAAGAGAAACAGTCAGG + Intergenic
1090043525 11:123311333-123311355 AAGGAGAATGAGAATTGGTAGGG - Intergenic
1090608581 11:128450436-128450458 CAGGAGTAGAAGAAATGATATGG + Intergenic
1091291663 11:134443770-134443792 CAGGAGAGGGAGGATTGCTCTGG - Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092597242 12:10021051-10021073 CAGGAGCAGGAGAGAGGGTGTGG - Intergenic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1092850308 12:12620104-12620126 CAGGAAAAGCAGAAAATGTCTGG - Intronic
1092915831 12:13188305-13188327 CATGGGAAGGATAAAGGGTCTGG - Intergenic
1093306053 12:17521154-17521176 AAGGCAAACGAGAAATGGTCAGG + Intergenic
1094164744 12:27431415-27431437 GAGGAGAAGAGGAAATGGTATGG - Intergenic
1094439336 12:30457351-30457373 CTGGAGCTGGAGAAATGGTGAGG - Intergenic
1095100269 12:38174623-38174645 TAGGAGAAGGAGAAAAGTTAGGG - Intergenic
1095799448 12:46257018-46257040 GTGGAGAAGGCGAAATGCTCAGG + Intronic
1095958954 12:47821649-47821671 CAACAGAAGGAGAAAGGGGCTGG - Intronic
1096670414 12:53195342-53195364 CAGGGGAAGGGGAGATGGTGAGG - Intronic
1096748919 12:53746549-53746571 TAGGAGAACGAGAAATGGAAGGG + Intergenic
1096774593 12:53956233-53956255 GAGGCGAAGGTGAAAGGGTCTGG + Intronic
1096973184 12:55683655-55683677 CAGGGGATGCAGAAAAGGTCAGG + Intronic
1097047421 12:56197601-56197623 CAGGAAATGGAAACATGGTCTGG - Intergenic
1099326560 12:81223316-81223338 CTGAAGAATGAGAAATTGTCAGG - Intronic
1101013723 12:100477516-100477538 AAAGAAAAGGAGAAATGGTATGG + Intronic
1101256655 12:102984456-102984478 CAGGAGCAGGAGAAATGGTCTGG + Intergenic
1101572017 12:105962332-105962354 CAGGAGGAGAAGAAAGGGTAGGG + Intergenic
1101851165 12:108403514-108403536 CAGAAGAAGGAAAAAAGGCCAGG - Intergenic
1102160356 12:110763813-110763835 CAGGAGATGGAGATAAGGTGAGG + Intergenic
1102296618 12:111741982-111742004 AAGGAGAAGGACACATGGGCTGG - Intronic
1102682267 12:114698770-114698792 CAGGAGAGGGAGAGATGGAGAGG - Intergenic
1102909192 12:116699694-116699716 CTGGAGAAGGGGAAATGTTTTGG - Intergenic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1104538384 12:129640146-129640168 CAAGTGAAGGAGAAATGGTAGGG - Intronic
1104724710 12:131068597-131068619 CAGGAGAAGCAGATATGCTGTGG - Intronic
1105891705 13:24686870-24686892 CAGGAGGAGGAGAGCCGGTCGGG + Intronic
1106455293 13:29921465-29921487 CAGGAGAGGCAGAATTAGTCAGG - Intergenic
1107357939 13:39587935-39587957 CAAGAGAAGGAGAAATAACCTGG + Intronic
1107417379 13:40213125-40213147 AAGAAGAAAGAAAAATGGTCTGG + Intergenic
1108882434 13:55137105-55137127 CAGGAGTAGGAGAAAGAGACCGG - Intergenic
1109608420 13:64730574-64730596 CTGGAGTAGGAGAAATAGTGGGG - Intergenic
1109928432 13:69180084-69180106 CAGGAAAAGCAGAAATCGTGGGG - Intergenic
1110511919 13:76361087-76361109 CAGGATAAGAAAAAATGGCCTGG + Intergenic
1110718408 13:78733630-78733652 CAGGAGAAGGAGAGGTGGCTTGG + Intergenic
1110901710 13:80833301-80833323 CAGGAGAAGGAGAGAGAGTGGGG + Intergenic
1110961705 13:81634425-81634447 CAAGCAAAGGAGAAATGGACAGG - Intergenic
1111204706 13:84990525-84990547 CTGGAGAAAGAAAAATGGGCAGG + Intergenic
1111756320 13:92400112-92400134 CTGGAGTAGGAGAATTGGTGTGG + Intronic
1112392671 13:98999471-98999493 CAGGAGAAGGCCAGATGATCTGG - Intronic
1114550875 14:23532203-23532225 TAGGAGAAAGAGAAAGGGTTGGG - Intronic
1114622256 14:24103264-24103286 CAGGAGAGGGAGGAATGGTGAGG - Intronic
1114673446 14:24426834-24426856 CAGGAGAAAGAGAGATAGTGGGG + Exonic
1115177540 14:30581409-30581431 CAGGAAAAGGAAAACTGGCCAGG + Intronic
1115677592 14:35696527-35696549 CTGGAGGAGGAAAAATGGGCTGG + Intronic
1116030729 14:39568032-39568054 CAGGAGATGAAGAGATGGGCTGG + Intergenic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1119870127 14:78009841-78009863 AAAGAGAAGGAGAAATGGAGAGG - Intergenic
1119915818 14:78400822-78400844 GAGGAGAATGGGAAATGGTGAGG - Intronic
1121692256 14:95886248-95886270 TAGGAGAGGGGGACATGGTCTGG + Intergenic
1122533570 14:102445983-102446005 AAGGGGAAGCAGAAAAGGTCGGG - Intronic
1124378109 15:29141423-29141445 CAGGAGATGGAGGCATGGGCTGG - Intronic
1125313920 15:38410723-38410745 CAGAAGCAGGGGAAATGGTGAGG + Intergenic
1125337517 15:38641808-38641830 TTGGAGAAGGAAAAATGATCAGG - Intergenic
1126378150 15:48017550-48017572 CAGGAGAAGGAGTTACGGTTTGG - Intergenic
1127604739 15:60574980-60575002 CAGGAGAAGAAGAGGAGGTCTGG + Intronic
1127768524 15:62211201-62211223 CCAGAGAGGGTGAAATGGTCTGG + Intergenic
1128638352 15:69317523-69317545 CAGGTGAGGGGAAAATGGTCAGG - Intronic
1129429942 15:75492515-75492537 CAGGACAATGAGAATGGGTCAGG - Intronic
1130940385 15:88503305-88503327 CAGGAGAAAGAGAAATTATGTGG + Intergenic
1131676638 15:94676782-94676804 CAGGAGAAGGAGGTGGGGTCAGG - Intergenic
1131712514 15:95071526-95071548 CAGGAGGAGGAAAAATGTGCAGG - Intergenic
1132095060 15:98978081-98978103 CAAGAGATGGGGAAATGGTTGGG - Intronic
1133046759 16:3092427-3092449 GAGGTGAAGAAGGAATGGTCAGG + Intronic
1133107826 16:3525136-3525158 CAGGCCATGGAGAAATGGTACGG + Intronic
1133110793 16:3546954-3546976 CTGAAGGAGAAGAAATGGTCAGG + Intronic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134861145 16:17561592-17561614 CAGCAGAAGGAAGAATGTTCTGG - Intergenic
1135140220 16:19914941-19914963 CAGGGGAAGGAGAAATACCCAGG - Intergenic
1135282411 16:21164021-21164043 CAGGAGAAAGACGAAGGGTCAGG - Intronic
1137832255 16:51555037-51555059 CAGGAGAAAGAGCACTGCTCTGG - Intergenic
1137891545 16:52168035-52168057 CAGGAGAATGAGAAATAAACTGG + Intergenic
1138273763 16:55716001-55716023 CATGAGTGGGTGAAATGGTCAGG + Intergenic
1138593075 16:58013218-58013240 CAGGAGAAGGAGTTTTGGTTGGG + Intronic
1138626980 16:58260229-58260251 CATGAGAGGGAGAAGGGGTCAGG + Intronic
1139583550 16:67886757-67886779 GAGGAGGAGGTGAAATGGTCAGG - Intronic
1140579277 16:76210014-76210036 CTGGAGTAGAAGAAATGGTTAGG - Intergenic
1141508275 16:84495425-84495447 CAGGGGAAGGAGGGAGGGTCTGG - Intronic
1141980375 16:87546562-87546584 CAGTGGCAGCAGAAATGGTCCGG - Intergenic
1143075800 17:4342200-4342222 CAGGACAAGGAGAGATAATCAGG - Intronic
1144234298 17:13242301-13242323 CAGGAGAATGAGAAGTGTTCTGG + Intergenic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144703575 17:17353489-17353511 CAGGACAGGCAGAAAGGGTCAGG + Intergenic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1145905135 17:28512104-28512126 AAGGGGATGGAGAAATGGGCTGG - Intronic
1146501916 17:33372069-33372091 CAGGAGAGGCAGAGAGGGTCTGG - Intronic
1147572089 17:41577577-41577599 CAGGAGAAGGACAAAGGGGAGGG + Intergenic
1147937114 17:44018424-44018446 AAGGAGAATGAGAAAAAGTCTGG + Intronic
1148743968 17:49908230-49908252 CAGGAGGAGGACAGGTGGTCAGG + Intergenic
1149804341 17:59600932-59600954 CTGGAGATGGAGAAGTGGTAAGG - Intronic
1150203789 17:63384759-63384781 TAGGAGTAGAAGAAATTGTCTGG + Intronic
1151138649 17:71971260-71971282 TAGAAGATGGAGAAATGGTCTGG + Intergenic
1151520966 17:74629301-74629323 GAGGAGAAGAAGAAGTGGTGGGG + Intergenic
1151953152 17:77366346-77366368 CAGGAGTAGGAGGAACGCTCTGG + Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152965541 18:111159-111181 CAGGAGATGTAAAAATTGTCTGG + Intergenic
1156787202 18:40929718-40929740 CAGGAGAGGCAGAAACGATCTGG - Intergenic
1157182779 18:45512150-45512172 CAGCAGAAAGAGAAATGCTTGGG + Intronic
1157556136 18:48613925-48613947 CAGGAGTAGGAAAAATGCTGAGG - Intronic
1157568646 18:48697660-48697682 CAGCAGAAGGAGCACTGGGCTGG - Intronic
1157622899 18:49026439-49026461 CAGGGGATGGAGAAATGGCAGGG - Intergenic
1157989589 18:52478697-52478719 CAGGAGCAGGAGAGATCATCAGG + Intronic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1158571259 18:58598534-58598556 CATGAGGAGGAGAAATAGGCTGG + Intronic
1159539422 18:69756188-69756210 CAGGAGACGGTGAAATGGCTAGG - Intronic
1159859169 18:73626747-73626769 GAAGAGAAGGAGAGATGGTAAGG + Intergenic
1160853296 19:1205228-1205250 CAGGGGAAAGAGAAACGCTCAGG - Intronic
1161010172 19:1956063-1956085 CAGGAGGATGAGAAAGGGGCAGG - Intronic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1163758112 19:19118985-19119007 CAGGAGAAGGTTAGATGGGCAGG - Intergenic
1163827368 19:19531102-19531124 CAGGAGAAGGAGGACTGCTATGG - Intronic
1164763726 19:30747060-30747082 CAGGAGAAGGAGGCATGGCAGGG + Intergenic
1164938843 19:32235834-32235856 CAAGAGAAAAAGAAATGGTTTGG + Intergenic
1165364797 19:35358903-35358925 CCGGAGAAGTAGGACTGGTCGGG - Exonic
1165366615 19:35371372-35371394 CCGGAGAAGTAGGACTGGTCGGG - Exonic
1165391535 19:35541985-35542007 CAGCATATGGAGAAAGGGTCTGG + Intronic
1166944637 19:46389489-46389511 CAGGAGAAAGAGAACTTGGCAGG - Intronic
1167420298 19:49398843-49398865 GAGGAGAAGGAGACCTGGTGTGG - Intronic
927140868 2:20129989-20130011 CAGCAGAAGGTGACATGGCCTGG - Intergenic
927312787 2:21649373-21649395 TAGAAGAAGGAGAGATGATCTGG + Intergenic
927400890 2:22708390-22708412 CAGGAGAAGGAGAAGTGAGTGGG + Intergenic
929368140 2:41186876-41186898 CAGGAGAAAGAGAAAAGGAAAGG - Intergenic
929591002 2:43146230-43146252 GAGGGGAAGGAGGAATGGTAGGG - Intergenic
931116946 2:59175129-59175151 GAGGAGGAGGAGAAATGCTGAGG - Intergenic
932572473 2:72945309-72945331 CAGAAGAAAGAGATCTGGTCTGG - Intronic
932672251 2:73748413-73748435 CAGGAGAGGAAGAAATGACCAGG + Intergenic
933029067 2:77303053-77303075 CAGGAAAAGCAAAAATTGTCAGG - Intronic
935803382 2:106722619-106722641 GAGGAGGAGGAGAAATGGGAGGG + Intergenic
936163566 2:110102281-110102303 CTGGAGGAGGTGACATGGTCTGG - Intronic
936538881 2:113334080-113334102 TAGGAGAAGGACAAGGGGTCAGG + Intergenic
938589405 2:132722281-132722303 CAGGAGAAGTAGGAATGGAGGGG - Intronic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
939290405 2:140187139-140187161 CTGGAGAAGGAGAAATAATGTGG - Intergenic
940820208 2:158345492-158345514 GAGGAGAAAGAAAAATGGTTGGG + Intronic
941644466 2:168025158-168025180 AATGAGAAGGGGAAATGGTGAGG - Intronic
943004935 2:182377302-182377324 CAGGAGAAAGATAAAGGGTCAGG - Intronic
944122620 2:196256982-196257004 ATGGAGAATTAGAAATGGTCAGG + Intronic
944876342 2:203966712-203966734 AGGGTGAAGGAGAAGTGGTCGGG + Intergenic
945188793 2:207166077-207166099 CAGGAGGAGGAGAAAAGGGAGGG - Intronic
946153416 2:217791287-217791309 AAAGAGAATGAGAAAGGGTCTGG - Intergenic
946309157 2:218873186-218873208 GAGGAGCAGGAGGAATGGTGAGG - Intronic
946334947 2:219030219-219030241 AAGCAGAAGGACAAAGGGTCAGG + Intronic
946914737 2:224506371-224506393 CAGGAGAATGAGAAACAGTGAGG - Intronic
947578370 2:231294608-231294630 CAGGAGAAGGGGAGCTGGGCAGG + Intronic
948219058 2:236254980-236255002 CAGGAGCAGGAGAAAGAGTGGGG - Intronic
1169065234 20:2691495-2691517 CAGGAGATGGAGAAAGAGACTGG + Intergenic
1169354910 20:4898112-4898134 TAGGGGAAGGAGATGTGGTCTGG - Intronic
1169404373 20:5311283-5311305 CAGGATAGGGAGAAAGGGTAAGG + Intronic
1169768222 20:9172431-9172453 CAGGAAAGGGAGAGATGGACAGG - Intronic
1169937179 20:10896220-10896242 CTGGAGCAGGAGAAAAGATCAGG - Intergenic
1170528687 20:17267358-17267380 CAGGAAAAGGAGAAATGCAATGG + Intronic
1170719232 20:18860555-18860577 CAAGAGAGGAAGAAATGGTAGGG - Intergenic
1170786148 20:19469289-19469311 AAGGAGATGGAGAAATGGTTTGG + Intronic
1171219583 20:23382852-23382874 GAGGAGAAAGAGAAAAGGGCTGG + Intronic
1172484649 20:35291053-35291075 CAGGAGAAAGAGAATTGGGAGGG - Intronic
1173185932 20:40840303-40840325 CAGGAGAGAGAGACATGCTCTGG + Intergenic
1175200512 20:57273797-57273819 CAGAAGAAGGAGAAAAGGCAGGG - Intergenic
1177010408 21:15725165-15725187 GAGGAGAAAGAGAAATAGCCTGG + Intergenic
1177245040 21:18512322-18512344 CTGGAGGAGGAGAAATGCTTGGG - Intergenic
1178158375 21:29881691-29881713 CAGTAGAAGAAGAAAGGGACAGG - Intronic
1178670481 21:34586655-34586677 AAGTAGAAGGAGAAAAGGACAGG + Intronic
1178799469 21:35779039-35779061 AAGGAGAGGGAGAAATGTACTGG + Intronic
1179619288 21:42602044-42602066 CAAGAGAGGGAAGAATGGTCTGG - Intergenic
1179914383 21:44466962-44466984 CAGGAGAGGGGGCAATGGCCTGG + Intergenic
1180737023 22:18024676-18024698 GGGGAGGAGGAGAAATGGTTTGG - Intergenic
1180874887 22:19170608-19170630 CAGGAGAAGGAGTCAGGGTTGGG - Intergenic
1181340883 22:22178938-22178960 CAGGAGGAGGAGAGAAGTTCTGG - Intergenic
1181602185 22:23959215-23959237 CAGGAAAAGGACAAGAGGTCAGG - Intronic
1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG + Intronic
1181873853 22:25924603-25924625 TGGGAGAAGGAGAAATAGGCAGG + Intronic
1181948605 22:26538225-26538247 CAGGGGAAGGTGAAAGGGTGTGG + Intronic
1183746283 22:39693935-39693957 GAGGAGGAGGAGAGAGGGTCTGG + Intergenic
1183747661 22:39700861-39700883 CAGAGGAAGAAGAAATGGTTTGG + Intergenic
1184212475 22:43044034-43044056 GAGGAGAAGGGGCAGTGGTCAGG - Intronic
1184726521 22:46350545-46350567 CTGGAGAAGGGGAAGTGGTGCGG - Intronic
950650460 3:14403711-14403733 CAGAAGGAAGAGAAATAGTCTGG - Intronic
950885929 3:16362860-16362882 CAGGGGATGGAGAAAAAGTCTGG - Intronic
951025963 3:17830192-17830214 GACAAGAAGAAGAAATGGTCTGG - Intronic
951530525 3:23694279-23694301 CAGGAGCAGGAGCAAAGGCCAGG - Intergenic
951949197 3:28180411-28180433 GAGGAGATGGAGAGATGGACAGG + Intergenic
951966088 3:28386914-28386936 AAGGAGAAGGAGAATTGGTGGGG + Intronic
952726824 3:36595308-36595330 AAGGAGAAGGAGAAAGGGAAGGG - Intergenic
953435079 3:42871602-42871624 TAGAAGGAGGAGAAATGGGCTGG - Intronic
953450562 3:43001842-43001864 CAGGAGAAGGGGAAGGGGTGAGG - Intronic
953631461 3:44621560-44621582 CAGCAGAAGGACCAAGGGTCGGG - Intronic
954727536 3:52626688-52626710 CGTGAGAAGGAGAAACGGTTAGG + Intronic
955631620 3:60981261-60981283 GGGGAGAAGGAGAAAAGGCCTGG - Intronic
955645640 3:61134530-61134552 CAAAGGAAGGAGAAATGATCTGG + Intronic
955803800 3:62713222-62713244 CAGGAGAAGGAGAAATGGTCTGG - Intronic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
956997758 3:74847731-74847753 CAGGAGAAGGAGATCAGGTATGG + Intergenic
957030307 3:75233064-75233086 CAGAAGATGGAGATAAGGTCAGG + Intergenic
957421093 3:79971294-79971316 AAAGAGTAGGAGAAATGGTTTGG + Intergenic
957628427 3:82685790-82685812 CAGGGGTAGGAGTAATGGTGTGG + Intergenic
957843238 3:85698579-85698601 CAGGAGAAGGAGAGGTGGGGTGG + Intronic
957881292 3:86216518-86216540 GAGGAGAAGGGGAAATCTTCAGG + Intergenic
958835904 3:99144662-99144684 GAGGAGGAAGAGAAATGATCAGG - Intergenic
959497100 3:107064382-107064404 GAGAATAAGGAGAAATGGTAAGG + Intergenic
960198620 3:114803041-114803063 GAGGAGAAGGAGAAATGGCATGG - Intronic
960391380 3:117081459-117081481 TGGAGGAAGGAGAAATGGTCTGG - Intronic
962463909 3:135639332-135639354 CAGGAGAAGAAGACCTGGTCTGG - Intergenic
963989428 3:151635948-151635970 CACGACTCGGAGAAATGGTCTGG - Intergenic
964367228 3:155963356-155963378 CAGGAGAAAGAGACATGGGCAGG - Intergenic
964447138 3:156771340-156771362 CAGCAGAAGGAGAAAATGTGAGG - Intergenic
964832663 3:160902447-160902469 CAGGTGGAGAAGAAATGGGCAGG + Intronic
965559428 3:170047178-170047200 CAGGAGAAGGACGAAGGGTTAGG - Intronic
965807339 3:172555613-172555635 AAGGAGAGGGAGACATGGTGTGG - Intergenic
966157217 3:176929831-176929853 CTGGAGAAAGAGAGTTGGTCAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
967275423 3:187769450-187769472 CAGGAGAATGAGAAATAGCCAGG + Intergenic
967364833 3:188674265-188674287 CAGGAGAAGGAAAAATTGTCAGG - Intronic
967909866 3:194533297-194533319 CAGGAGATGGGGAAAAGGCCAGG + Intergenic
968336501 3:197918029-197918051 AAGAAGGAGGAGAAATGGGCTGG - Intronic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
969956833 4:10899141-10899163 TAGCATAAAGAGAAATGGTCAGG + Intergenic
970909669 4:21260080-21260102 ACGGAGAAGGTGAGATGGTCAGG + Intronic
971317727 4:25581317-25581339 CAGGAGAGGAAGAAAGAGTCTGG - Intergenic
972395833 4:38659049-38659071 CACGAGGAGGAGAAATGCCCTGG + Intergenic
972817274 4:42657522-42657544 CAGGCGAAGGCGAAAGGGTCTGG + Intergenic
972848190 4:43015141-43015163 CAGGAGAAGGAGAGAAATTCAGG + Intronic
973288023 4:48441140-48441162 CAGGAGAAGGAGAAGTGCGTGGG - Intergenic
974003947 4:56537172-56537194 CCTGAGAAGGAGAAACAGTCAGG - Intronic
974647759 4:64716536-64716558 CAGGAGAAGGAAAGAGGCTCTGG - Intergenic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
979885803 4:126025855-126025877 CAGGATAAAGAGAAAAGGTGGGG - Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
980884733 4:138749954-138749976 CAGGAGAAAGAAAAATGGATAGG + Intergenic
981756087 4:148142901-148142923 CAGGAGCAAGAGAGATGGTGGGG - Intronic
983522365 4:168723101-168723123 CAGGAGCAGAGGAAGTGGTCAGG + Intronic
984708306 4:182863778-182863800 CAGGAGAAGGGGCAGTGCTCTGG - Intergenic
985443555 4:190004297-190004319 TAGGAGAAGGAGAAAAGTTAGGG + Intergenic
985463880 4:190176250-190176272 CAGGAGATGTAAAAATTGTCTGG - Intronic
985886117 5:2680638-2680660 CAGCAGCAGGAGAGATGCTCCGG + Intergenic
986116728 5:4782511-4782533 CAGGAGAGGGGGAAGTGGTGAGG + Intergenic
986152663 5:5141151-5141173 GAGGAGAAGGAGGAAAGGTTGGG - Intronic
986278720 5:6304949-6304971 CAGCAGGAGGAGAGATGGTGAGG + Intergenic
987190402 5:15471327-15471349 AAGGAGCAGCAGCAATGGTCAGG + Intergenic
987420710 5:17717091-17717113 CAGGAGAGGGAGGAATGAACAGG + Intergenic
987628894 5:20441947-20441969 CGAGAGAAACAGAAATGGTCAGG + Intronic
989671763 5:43925377-43925399 GAGGAGAGGGAGAAGTGGTGAGG - Intergenic
990119724 5:52436134-52436156 TAGTAGAAGGAGAACTGGACTGG + Intergenic
990865191 5:60372411-60372433 CAGGAGATGGAGACATGATTTGG - Intronic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
991599921 5:68341967-68341989 CAGGAGAAGGGGTAAGGGCCAGG + Intergenic
993676936 5:90826935-90826957 CAGGAAAAGGGGAAATGGACTGG - Intronic
993701367 5:91122941-91122963 CAGGAGTAGGAGAAACAGGCAGG - Intronic
995412871 5:111878390-111878412 AGGGTGAAGGAGGAATGGTCAGG + Intronic
996366433 5:122706136-122706158 CAGGACAAGGGCAAATGGTTAGG + Intergenic
996663817 5:126034839-126034861 CTGGAGAAGGAGGAATGGCCTGG - Intergenic
998165800 5:139842875-139842897 AAGGAGGAGGAGAAAGGGTGGGG - Exonic
998307059 5:141088995-141089017 CAGTAGAAGGAGACTAGGTCTGG + Intergenic
1001028580 5:168245060-168245082 CAAGAGCAGCAGAAATGGTCAGG - Intronic
1001169832 5:169408681-169408703 CAGGAGACAGAGAGATGTTCAGG + Intergenic
1001181025 5:169520718-169520740 TAGGAGGAGGAGAAATGATGGGG + Intergenic
1001378420 5:171284885-171284907 CAGGAGAAGGTGACATGATGAGG - Intronic
1002161795 5:177318471-177318493 CATGAGCCGGTGAAATGGTCAGG - Intergenic
1002761558 6:206285-206307 CAGTAGAAGAAGAAAAGGCCTGG + Intergenic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003551981 6:7108308-7108330 GAGGAGGAGGAGGAATGGCCCGG - Intronic
1004437648 6:15612901-15612923 TAGCAGAGGTAGAAATGGTCAGG - Intronic
1004747608 6:18526890-18526912 CAGATGAAGGATAAATGGACAGG + Intergenic
1004930472 6:20458460-20458482 GAGGAAGTGGAGAAATGGTCTGG - Intronic
1005979187 6:30823371-30823393 AAGAAGAAGAAGAAATGGGCTGG - Intergenic
1006173729 6:32109632-32109654 CAGCAGGTGGAGAAATGGTGGGG - Intronic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1007679800 6:43626189-43626211 CAGGTAAAGGAGAACTGGTGGGG + Intronic
1008048841 6:46879472-46879494 CAGGAGAGGGAGAGAGGGTCTGG - Intronic
1009722748 6:67495720-67495742 AAGGAGAAGGAGAAGTAGTATGG + Intergenic
1012305101 6:97645939-97645961 AAGGTGAAGGAGAAAGTGTCAGG + Intergenic
1012593790 6:101016673-101016695 CAGCAGTAGGAGAAATGGAAAGG + Intergenic
1013235332 6:108193611-108193633 TAGTAGAAGGAGCATTGGTCAGG + Intergenic
1013590129 6:111612805-111612827 CAGGAAGAGAAGAAATGCTCAGG + Intergenic
1014244996 6:119058497-119058519 TAAGAGAAGGAGAATTGGGCTGG - Intronic
1015063392 6:128996209-128996231 CAGGAGAATGAGAAAGAGTTTGG + Intronic
1015091260 6:129362181-129362203 CAGGAAAGGGAGAGATGGACGGG - Intronic
1015150308 6:130030084-130030106 CAGGTGAATCAAAAATGGTCAGG - Intronic
1016865182 6:148759205-148759227 CAGGAGAGGGAGAAAGGGCATGG + Intronic
1016908048 6:149170811-149170833 CAGGAGAAGGAGAAATTATGTGG - Intergenic
1017598306 6:156053847-156053869 TAGGACAAGGTGAAAGGGTCAGG + Intergenic
1017645245 6:156534064-156534086 CAGGGGAAGGCTAAATGGCCAGG + Intergenic
1017925278 6:158906517-158906539 CAGGAGCAAGAAAAATGGTGGGG - Intronic
1018055521 6:160049003-160049025 CAGGAGACGGGTAAATGTTCTGG - Intronic
1018109744 6:160523573-160523595 CAGGAGCAGGAGCAAGGGTGGGG - Intergenic
1018285385 6:162232189-162232211 CAGGAGATGCAGAAATTGTCAGG - Intronic
1018440970 6:163813061-163813083 CAGGAGTAGGAGAAAGAGTTGGG - Intergenic
1018887874 6:167956826-167956848 CAGGAAAAGGAGAGAGGCTCTGG - Intronic
1019174187 6:170151713-170151735 CAGCAGAAGGAGACAGGGGCAGG - Intergenic
1019526368 7:1482227-1482249 GAGGAGGAGGAGAAGTGGTGGGG - Intronic
1020563690 7:9768767-9768789 CAGGAAAAGAAGAAATGGTGGGG + Intergenic
1021017940 7:15558927-15558949 CAGGACAAGAAGAAATGGGTGGG + Intronic
1022691653 7:32662200-32662222 CAGGAGAAGGAGGAAGCATCTGG - Intergenic
1022919273 7:34996437-34996459 CAGGAGAAGGAGGAAGCATCTGG - Intronic
1022946812 7:35293852-35293874 CAGGAGAAGGGGAAAGGTTTAGG - Intergenic
1023344866 7:39261205-39261227 CAGGAGCAGGAGAGGTGGCCTGG - Intronic
1023379103 7:39588213-39588235 TAGAAGAAGGAAAAATGGGCCGG + Intronic
1024090547 7:45936329-45936351 CAGGTGAAGGAGTAATGACCTGG + Intergenic
1026541380 7:71282743-71282765 CAGGTGAAGCAGATATGGTAGGG + Intronic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027841673 7:83320224-83320246 AAGGAGAAGGAGCAGTGGCCTGG + Intergenic
1029592668 7:101517671-101517693 CAAGAGATGGTGAAATGGTTTGG - Intronic
1030107695 7:106000382-106000404 CAGAGGAAGGAGAAATGGCAGGG - Intronic
1030184391 7:106746576-106746598 CAGGAGAAGGAATAATAATCTGG - Intergenic
1030585582 7:111414493-111414515 CAGTAGTAGGAGTAATGGGCAGG + Intronic
1030629843 7:111883711-111883733 CAGGAAAAGGTGATGTGGTCAGG + Intronic
1031290368 7:119927431-119927453 CAGGAGAAGGAGAGCTTGTATGG - Intergenic
1034189998 7:149206630-149206652 CAGGAGAAGGGGAGGTGGTGGGG + Intronic
1034279396 7:149842076-149842098 CAGGAGAAGGATAAATGCTTGGG + Intronic
1034351749 7:150420334-150420356 AAGGAAAGGGAGAAATGGACGGG - Intergenic
1034685451 7:152967073-152967095 CAACAGAAGGTAAAATGGTCTGG - Intergenic
1035487763 7:159240937-159240959 GAGGAGAAGGAGGGATGGACAGG + Intergenic
1035569311 8:661493-661515 CAGGAGCATGAGGAATTGTCAGG - Intronic
1036068864 8:5417837-5417859 GAGGAGAACGGGAAATGGTTTGG + Intergenic
1037218216 8:16484057-16484079 AAGGAGAAGAAGAAAGGGTAGGG + Intronic
1037529411 8:19758280-19758302 CAGTAGAAGGAGCCATGGCCAGG - Intergenic
1038722241 8:30047317-30047339 CAGGAGATGGAGAAAGGGAGAGG - Intergenic
1041249180 8:55918259-55918281 CAGGAGAGGGAGGAATGGGGTGG - Intronic
1042749222 8:72139948-72139970 CAGGAGGAGGAGAAAGAGTGGGG - Intergenic
1043030317 8:75126385-75126407 CAAGAGAAAGAGAAATGTTTGGG - Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043490470 8:80743070-80743092 CAGGGGAAGGAACAATGATCGGG + Intronic
1044428938 8:92086368-92086390 CAGGAGAATGCAAAGTGGTCAGG - Intronic
1046339629 8:112836234-112836256 CAGGAGAAGAAAAATGGGTCTGG + Intronic
1046646828 8:116794371-116794393 CAGGAAAGGGAGAAATGGCTTGG + Intronic
1047200037 8:122757364-122757386 AAGGAGAAGGAGATGTGGTAAGG - Intergenic
1047268243 8:123329187-123329209 CAGCAGTATGAGAAATGGACTGG + Intronic
1047896153 8:129368679-129368701 CAGGAGAAAGGGAAATAGTTAGG + Intergenic
1048250966 8:132866611-132866633 AAGGAGAAGGAGAAAGGGTAGGG + Intergenic
1049234493 8:141505675-141505697 GAGGAGAAGGAGACATGCTCTGG - Intergenic
1049450027 8:142655619-142655641 CAGGAGCAGCAGGGATGGTCAGG - Intergenic
1049523905 8:143110964-143110986 CAAGAGAGGGTAAAATGGTCTGG - Intergenic
1050125043 9:2348016-2348038 CAGGAGAAGGAGCAAGAGTGGGG - Intergenic
1051640120 9:19216819-19216841 TTCGAGAAGGAGGAATGGTCAGG + Intergenic
1054810045 9:69427275-69427297 CTGGAGAAAGAGAAATTCTCCGG - Intergenic
1055858267 9:80718052-80718074 CAGGAGTAGGGGAAATGGGAAGG - Intergenic
1056893985 9:90523526-90523548 CAGGGGAAGGAAAAATGGAATGG + Intergenic
1057423075 9:94927662-94927684 CAGGGGAGGGAGAGATGGGCAGG - Intronic
1057919406 9:99084575-99084597 CTTAAAAAGGAGAAATGGTCCGG + Intergenic
1058142957 9:101377451-101377473 CAAGAGAGGGTAAAATGGTCTGG + Intronic
1058728788 9:107829416-107829438 AAGGAAAAGGAGAAAGGGTAGGG - Intergenic
1059455396 9:114397401-114397423 CAGAAGGAGAAGAAATGGGCTGG - Intergenic
1059644769 9:116254013-116254035 CAGGAGAAAGAGGAAAGGACTGG - Intronic
1060044937 9:120332478-120332500 CAAGAGAAGGATACATGGCCAGG + Intergenic
1060572147 9:124651897-124651919 TGGGAGAGGCAGAAATGGTCAGG - Intronic
1061864293 9:133484665-133484687 CAGCAGAAAGAGAGCTGGTCTGG + Intergenic
1061889939 9:133613552-133613574 CAAGAGAAGGTGAGAGGGTCGGG + Intergenic
1062184009 9:135206872-135206894 CAGGAGCAGGGGAGATGCTCAGG + Intergenic
1062215779 9:135389122-135389144 CTGGGGAAGGAGCAGTGGTCAGG + Intergenic
1062309153 9:135926653-135926675 CAGCTGAAGGAGAGAGGGTCCGG - Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186639502 X:11440511-11440533 CAGGCAAAGGAGAAATGGAAGGG - Intronic
1188284450 X:28311147-28311169 TAGGAGAAGGGGAAATGGAGTGG - Intergenic
1188515603 X:30982209-30982231 TTGGAGAAGGATAAATGGTTTGG - Intergenic
1189236719 X:39492646-39492668 CAGGAAAAGGAAAACTGATCTGG - Intergenic
1189411622 X:40777945-40777967 GAAGAGAGGGAGAAATGGTGGGG - Intergenic
1189877613 X:45453167-45453189 CAAGACAAGGACAAATGCTCGGG - Intergenic
1190539081 X:51458699-51458721 CAGGAGAAGGACAGAGGCTCTGG + Intergenic
1190728475 X:53208277-53208299 CACGAGCAGGAGAAATGCTGTGG + Intronic
1191785909 X:64917039-64917061 CAGGAGATGTAGAGTTGGTCTGG + Exonic
1195702050 X:107712935-107712957 CAGGAGAGGGAGGAAGGATCTGG + Intergenic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1197053971 X:122094546-122094568 AAGGGGAAGGAGAAATGGGAAGG + Intergenic
1197247641 X:124182464-124182486 CAGGAGAAAGTGAAATGTTGTGG - Intronic
1197322751 X:125052774-125052796 TAAGAGAAGGACAAATGTTCCGG + Intergenic
1197902490 X:131389167-131389189 CATGAGAAAGAGAAGTAGTCAGG + Intronic
1198368943 X:135973135-135973157 CAGGAGAAAGAGCACTGGACTGG - Intronic
1198581295 X:138067625-138067647 CAGGAAAGGAAGAAAAGGTCAGG + Intergenic
1199807265 X:151312705-151312727 AGAGAGAAGGAAAAATGGTCTGG - Intergenic