ID: 955805667

View in Genome Browser
Species Human (GRCh38)
Location 3:62731456-62731478
Sequence GTGGACTACCTCAGTTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955805667_955805669 -9 Left 955805667 3:62731456-62731478 CCTTCCAAACTGAGGTAGTCCAC 0: 1
1: 0
2: 0
3: 5
4: 116
Right 955805669 3:62731470-62731492 GTAGTCCACATTTGTCATTGTGG 0: 1
1: 0
2: 1
3: 5
4: 127
955805667_955805673 28 Left 955805667 3:62731456-62731478 CCTTCCAAACTGAGGTAGTCCAC 0: 1
1: 0
2: 0
3: 5
4: 116
Right 955805673 3:62731507-62731529 CCCAAATTAGTTTGCTTTGTTGG 0: 1
1: 0
2: 0
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955805667 Original CRISPR GTGGACTACCTCAGTTTGGA AGG (reversed) Intronic
900001415 1:16867-16889 CTCGGCTACCTCAGTGTGGAAGG + Intergenic
900021135 1:187389-187411 CTCGGCTACCTCAGTGTGGAAGG + Intergenic
902657239 1:17877652-17877674 GTGGACTGCAGCAGTCTGGAGGG - Intergenic
904309505 1:29619190-29619212 GTGGCCTACCTGAGGGTGGAAGG + Intergenic
904508733 1:30983183-30983205 GTGGACTGCCTCCTGTTGGAGGG - Intronic
904638765 1:31905466-31905488 TTGGAGTACCTCAGTCTGGAGGG - Intergenic
908168143 1:61479027-61479049 GAGGATTACCTGAGTCTGGAAGG - Intergenic
911482757 1:98464948-98464970 GTGCACTAGCCCAGTTTAGAAGG - Intergenic
912611218 1:111046680-111046702 GTGGCCTACCTGAGGGTGGAGGG - Intergenic
913530489 1:119730806-119730828 ATGGGCCACCTCAGTTTGGAGGG + Intronic
915957197 1:160231296-160231318 GTGGACGAGATCAGTTTGTAAGG - Exonic
919304646 1:195816355-195816377 GTGGACTACTAGAGTGTGGAGGG - Intergenic
919696067 1:200576917-200576939 GAGGATTACCTGAGTCTGGAAGG - Intronic
922854247 1:228760487-228760509 GTGAACTCACTCAGTTGGGATGG - Intergenic
1069559545 10:69419842-69419864 GTGGCCTATCTCTGTTTGGGAGG + Intergenic
1075500906 10:122973240-122973262 GTGGACTACATAGGTTTGGGAGG + Intronic
1076773565 10:132680628-132680650 GCCGACTCCCTCAGTTTGTAGGG + Intronic
1078614407 11:12851992-12852014 AATGACTAACTCAGTTTGGATGG + Intronic
1080232505 11:30033799-30033821 GGGGCCTACCTGAGTATGGAGGG + Intergenic
1080560222 11:33456498-33456520 GAGGATCACCTCAGTGTGGAAGG - Intergenic
1089142578 11:116298528-116298550 GTGGACTACTAGAGTATGGAGGG - Intergenic
1091374501 12:16982-17004 CTCGGCTACCTCAGTGTGGAAGG + Intergenic
1091429628 12:422698-422720 GTGGACAGCTTCAGTTTGGAAGG - Intronic
1095513885 12:42984624-42984646 GGGGCCTACCTGAGTGTGGAAGG + Intergenic
1107270831 13:38613972-38613994 GTTGAATACCTTAGTTTGAATGG - Intergenic
1113627676 13:111858560-111858582 GGGGACTTCCTGAGATTGGAGGG - Intergenic
1114279339 14:21176806-21176828 GTGGCCTACCTGAGGGTGGAGGG + Intergenic
1115386091 14:32798710-32798732 GGGGACTACCTGAGAATGGAGGG + Intronic
1115605234 14:34994372-34994394 TTAGACTACATTAGTTTGGAAGG + Intronic
1116280002 14:42894505-42894527 GTGGACTACCAGAGGGTGGAGGG - Intergenic
1117057429 14:51927361-51927383 GTGCACTCCCTCAGTTAGCAAGG - Intronic
1117116506 14:52518667-52518689 GTTGACTAACTTAGATTGGAAGG - Intronic
1121370845 14:93357012-93357034 GGGGCCTACTTCAGTTTGAAGGG - Intronic
1123814014 15:23958104-23958126 GGGGCCTACCTCAGGGTGGAAGG - Intergenic
1125843156 15:42824704-42824726 GGGGACTACTTCAGGATGGAGGG + Intronic
1127803062 15:62494161-62494183 GTGGTTTGCCTCAGTTTGGGTGG + Intronic
1128878062 15:71218250-71218272 GTGGACAAGCTGAGTTTTGAAGG + Intronic
1132452093 15:101974071-101974093 CTCGGCTACCTCAGTGTGGAAGG - Intergenic
1132454800 16:16550-16572 CTCGGCTACCTCAGTGTGGAAGG + Exonic
1133912773 16:10080877-10080899 ATGGGCTACCTGAGCTTGGAGGG - Intronic
1139196777 16:64928725-64928747 GTGGACTACTACAGAGTGGACGG + Intergenic
1143587812 17:7859532-7859554 TTTGACTATCTCAGTATGGACGG + Exonic
1149171765 17:53820621-53820643 AAGGACTACCTAAGTTAGGATGG + Intergenic
1152370419 17:79884668-79884690 GAGGATCACCTGAGTTTGGAAGG + Intergenic
1155084129 18:22440051-22440073 CTTGACTTCCTCAGTTGGGAAGG + Intergenic
1159354429 18:67319289-67319311 GAGGATAACCTCAGTGTGGAAGG + Intergenic
1159641389 18:70866433-70866455 GGGAACTACTACAGTTTGGAGGG - Intergenic
1162440903 19:10691546-10691568 GTCGGCTACCTGCGTTTGGAAGG - Exonic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1167842559 19:52133877-52133899 GGGGCCTACCTCAGGGTGGAGGG - Intronic
925534282 2:4899979-4900001 GTAGACTACCACAGTTTTCAAGG + Intergenic
936568310 2:113596547-113596569 CTCGGCTACCTCAGTGTGGAAGG - Intergenic
941480875 2:166010318-166010340 ATGAACTACATCAGTTTTGAAGG + Intronic
942410850 2:175708001-175708023 GGGGCCTACCTGAGATTGGAGGG - Intergenic
943298222 2:186164462-186164484 TGGCACTACCTCAGTGTGGAGGG - Intergenic
943636130 2:190308758-190308780 ATGGACTAACACAGTTAGGAAGG + Intronic
944934905 2:204557983-204558005 CTGGACTACCTCAATTTTGATGG + Intronic
946802853 2:223438751-223438773 GTGGACTACTAGAGGTTGGAGGG - Intergenic
1176905604 21:14496934-14496956 GTGCTCTACCTCAGTTTTGTGGG + Intronic
1177479395 21:21667465-21667487 GTGGACTACTACAGTGGGGATGG + Intergenic
1177531411 21:22363031-22363053 GTTGACTACCTGAGGGTGGATGG + Intergenic
1183584102 22:38742271-38742293 GTGGAATACCTCAGGGTGGGAGG - Intronic
1183884052 22:40862236-40862258 CTGGACTAGCTCTATTTGGAAGG - Intronic
1184223063 22:43112813-43112835 GAGGCCTACCTGAGCTTGGAGGG + Intronic
949113768 3:294773-294795 GTGGTCGACCGCAGTTTTGAAGG - Intronic
950001170 3:9657459-9657481 GTTGAGTACCTCTGTTTGGCAGG + Intronic
955805667 3:62731456-62731478 GTGGACTACCTCAGTTTGGAAGG - Intronic
956599386 3:71002962-71002984 GTGGACTCCCTGAGTGTTGAGGG + Intronic
957307111 3:78471485-78471507 GAGGACTACTACAGGTTGGAGGG - Intergenic
960994848 3:123333850-123333872 GAGGACTCCCTCAGGATGGAGGG - Intronic
963979780 3:151524616-151524638 GTGGTCTACTTGAGTGTGGAGGG + Intergenic
967953293 3:194857344-194857366 GTGGGCTCCCTCAGATGGGAGGG - Intergenic
971591674 4:28476727-28476749 GTGGGCTCTCTCAGTTTAGATGG - Intergenic
980446710 4:132919968-132919990 GGGCACTACCTCTGCTTGGAAGG - Intergenic
982304319 4:153913945-153913967 TTGGTCTACCACAGTTTAGATGG + Intergenic
982661220 4:158209588-158209610 GAGGACTCCCTCACTTTGGGAGG + Intronic
985845289 5:2340320-2340342 GGGGACTACCTGAGGGTGGAGGG - Intergenic
990074272 5:51823550-51823572 GTGGATTACTTGAGTTTAGATGG - Intergenic
996288381 5:121822824-121822846 GTGGACTACCAGAGGGTGGAGGG - Intergenic
1000658192 5:163907416-163907438 GGGGCCTACCTGAGGTTGGAAGG - Intergenic
1004455161 6:15785268-15785290 ATGGACTTCCTCAGTTTGCCTGG + Intergenic
1008246826 6:49185859-49185881 GGGGACTACCTGTGTATGGAAGG - Intergenic
1009860579 6:69325977-69325999 GTGGACTACCTGAGCGTGGGTGG + Intronic
1013437482 6:110125374-110125396 GTGAACTACCTCCTTTTGGTTGG + Intronic
1014831131 6:126104230-126104252 GTTGACTACATCACTTTGAACGG - Intergenic
1018357142 6:163029548-163029570 GTGGATTGCATCAATTTGGAAGG + Intronic
1018737720 6:166701100-166701122 GTGGACCACCTCAGTCAAGACGG - Intronic
1021137775 7:16986918-16986940 GTGTACTTCCTCATTTTGAAAGG - Intergenic
1021700253 7:23312368-23312390 GTGGACCACCTCAGTCAAGACGG - Exonic
1022762898 7:33376185-33376207 GGGGCCTACCTCAGAGTGGAGGG - Intronic
1025155135 7:56598317-56598339 GTGGACCACCTCAGTCAAGATGG + Intergenic
1026609048 7:71841069-71841091 GTTACCTAACTCAGTTTGGAAGG - Intronic
1035031461 7:155863724-155863746 CTGGACTCCTTCAGCTTGGAGGG + Intergenic
1035770258 8:2141619-2141641 TTGGAATACCTCTGGTTGGAGGG + Intronic
1037885366 8:22593350-22593372 GTGGATTACCTGAGGTTGGGAGG + Intronic
1039334043 8:36570555-36570577 GATGACTAACTCAGTCTGGAAGG + Intergenic
1041401149 8:57446686-57446708 GTGGACCACTTCAGGTTGGTAGG + Intergenic
1044009147 8:86970608-86970630 GTGGACTACTACAGGTGGGAGGG - Intronic
1045761063 8:105608166-105608188 GGGGACTACTTGAGTTTGGAGGG + Intronic
1049884220 9:16978-17000 CTCGGCTACCTCAGTGTGGAAGG + Intergenic
1053615214 9:39758641-39758663 GGGGCCTACCTGAGATTGGAGGG + Intergenic
1054238305 9:62583749-62583771 GGGGCCTACCTGAGATTGGAGGG - Intergenic
1054552435 9:66618269-66618291 GGGGCCTACCTGAGATTGGAGGG - Intergenic
1056456250 9:86763792-86763814 GTATTCTACCTCAGTTCGGAAGG - Intergenic
1060337086 9:122735300-122735322 GTGGCCTACCTGAGGGTGGAGGG + Intergenic
1060850616 9:126872173-126872195 GTGGAGCACCTCAGGTTGGGAGG - Intronic
1186408879 X:9328439-9328461 ATGGACTACCTCAATAAGGAAGG + Intergenic
1187515569 X:19966852-19966874 GTGGAATACCTTAGTTCAGATGG - Intronic
1188237521 X:27748049-27748071 GTGGACAAGATCAGTTTGTAAGG + Exonic
1188889504 X:35592852-35592874 GTGGACTACCAGAGTGGGGAAGG - Intergenic
1189036189 X:37495720-37495742 GGGGCCTACCTGAGTGTGGAGGG - Intronic
1189037697 X:37509262-37509284 GGGGCCTACCTGAGTGTGGAGGG - Intronic
1189223629 X:39394348-39394370 GTGGACTCTGTCAATTTGGATGG + Intergenic
1189973629 X:46441560-46441582 GTCTTCTACTTCAGTTTGGAAGG + Intergenic
1194984396 X:100474610-100474632 GGGGTCTACCTCAGGGTGGAAGG + Intergenic
1196488029 X:116236771-116236793 GTGGATTACCTCATTTGAGAAGG - Intergenic
1198974691 X:142323059-142323081 GGGGACTACCTGAGGGTGGAGGG - Intergenic
1199467373 X:148154263-148154285 GTGGGTTACCTGAGTTTGAAGGG - Intergenic
1200401583 X:156023178-156023200 CTCGGCTACCTCAGTGTGGAAGG - Intergenic
1201332045 Y:12835137-12835159 GAGGACTACTTGAGCTTGGAAGG - Intronic
1201671128 Y:16521658-16521680 GGGGACTACTTGAGATTGGAAGG - Intergenic
1202014632 Y:20387725-20387747 GTGGACTACGTGAGGGTGGAGGG + Intergenic