ID: 955806607

View in Genome Browser
Species Human (GRCh38)
Location 3:62742477-62742499
Sequence GTGGAAGATCAGATATTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3593
Summary {0: 1, 1: 7, 2: 202, 3: 1389, 4: 1994}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955806607_955806613 27 Left 955806607 3:62742477-62742499 CCTACAAATATCTGATCTTCCAC 0: 1
1: 7
2: 202
3: 1389
4: 1994
Right 955806613 3:62742527-62742549 AGGATTCCCTATTCAACAAATGG 0: 42
1: 950
2: 14586
3: 8346
4: 4989
955806607_955806609 1 Left 955806607 3:62742477-62742499 CCTACAAATATCTGATCTTCCAC 0: 1
1: 7
2: 202
3: 1389
4: 1994
Right 955806609 3:62742501-62742523 AACCCGACAAAAAGAAGCAATGG 0: 1
1: 92
2: 4841
3: 13123
4: 5597
955806607_955806612 7 Left 955806607 3:62742477-62742499 CCTACAAATATCTGATCTTCCAC 0: 1
1: 7
2: 202
3: 1389
4: 1994
Right 955806612 3:62742507-62742529 ACAAAAAGAAGCAATGGCAAAGG 0: 1
1: 2
2: 79
3: 271
4: 935

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955806607 Original CRISPR GTGGAAGATCAGATATTTGT AGG (reversed) Intronic
Too many off-targets to display for this crispr