ID: 955808184

View in Genome Browser
Species Human (GRCh38)
Location 3:62758472-62758494
Sequence CAGTCTGACAAAGAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955808184 Original CRISPR CAGTCTGACAAAGAGGAAGT GGG Intronic
901408351 1:9065533-9065555 CAGTTTCACAAACAGGTAGTGGG + Intronic
901800117 1:11703715-11703737 CAGCCTGGGACAGAGGAAGTGGG - Intronic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
905172685 1:36118468-36118490 CTGTCTTACAAATAGGAAGCTGG + Intronic
906088067 1:43152890-43152912 CAGACTGAAAACCAGGAAGTTGG + Exonic
908224936 1:62046412-62046434 GAGTCAGGCAAAAAGGAAGTTGG - Intronic
908574176 1:65441665-65441687 CAGAATGACGAAGGGGAAGTGGG + Intronic
911341047 1:96637832-96637854 CAGTCTGACAGAGAAGAAAATGG - Intergenic
913159111 1:116129275-116129297 CAATTTGAGAAAGAGGGAGTCGG - Intronic
915859812 1:159432169-159432191 GAGTCTGAAAGAGATGAAGTGGG - Intergenic
916354030 1:163884310-163884332 CAGTCAAGCAAACAGGAAGTGGG + Intergenic
917586071 1:176427025-176427047 CAGTCTGACACAGAGCTACTTGG - Intergenic
918767132 1:188500541-188500563 CGGTCTCACACAGAGGAAGTAGG - Intergenic
919293638 1:195666273-195666295 CAGAGAGACAAAGAGGAAGGTGG + Intergenic
920124886 1:203686294-203686316 CTGTCTCACAAACAGGAACTCGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063515718 10:6693210-6693232 GTGTCTGGCAAAGAAGAAGTGGG - Intergenic
1064832925 10:19491358-19491380 GGGACTGAGAAAGAGGAAGTTGG + Intronic
1066101211 10:32120333-32120355 AAGTTTGACAAAGAGGGAGGTGG + Intergenic
1067015991 10:42756587-42756609 CAGGATGACAAAGAGGGAGTAGG - Intergenic
1070789411 10:79180554-79180576 CAGTCTGGCCCAAAGGAAGTGGG + Intronic
1071044896 10:81361647-81361669 GAGTGTGTGAAAGAGGAAGTGGG + Intergenic
1071790951 10:88953370-88953392 ATGTCTTACAAAGAGGAATTTGG + Intronic
1072462109 10:95629169-95629191 CACTTTGAAAAAGAGTAAGTAGG + Intronic
1072688679 10:97555041-97555063 CAATCTGGCAAAGAGGAAGGAGG + Intronic
1072886402 10:99279344-99279366 CACTCTGATAAAGAGCATGTTGG + Intergenic
1073028341 10:100505223-100505245 CATTCTGAGACAGAGGCAGTGGG + Intronic
1073093794 10:100967953-100967975 AAGTCTGAGAAGGAGGAAGCAGG - Intergenic
1074533924 10:114315273-114315295 CTGTCTCACAAAGAGGAGGATGG + Intronic
1075715556 10:124553236-124553258 CAGCCTGACAAAGGGGAACTTGG + Intronic
1077758691 11:5066286-5066308 CATCCTTACAAAGTGGAAGTAGG + Intergenic
1079268257 11:18956780-18956802 GCTTCTGAGAAAGAGGAAGTCGG + Intergenic
1079369306 11:19836850-19836872 CTGTCTGCAAATGAGGAAGTGGG - Intronic
1079459554 11:20668483-20668505 TAGTAGGACAAATAGGAAGTGGG + Intergenic
1080684627 11:34504847-34504869 CAGGCTGAGAAAGAGGAGGGAGG + Intronic
1081975665 11:47233089-47233111 CAGTTTGAGAAAGAGAAAGAAGG - Intronic
1083081291 11:60096259-60096281 CAGATTGACAAGTAGGAAGTGGG + Intronic
1083549553 11:63576281-63576303 CAGTCTGTCAAAAAAAAAGTGGG - Intronic
1083840002 11:65298953-65298975 GAGTCAGACAAAGAGAAAGCGGG + Intronic
1085822341 11:79806163-79806185 CAATCTGACAAAGAAGAAATAGG - Intergenic
1085932072 11:81095710-81095732 CAAACCGAAAAAGAGGAAGTTGG - Intergenic
1085949982 11:81318780-81318802 CTGTCTGACAAAGGGGACTTTGG - Intergenic
1089355829 11:117852727-117852749 CAGTCTCAGAAAGAGAAAGTGGG - Intronic
1090166016 11:124548485-124548507 CAGTCTCAAAAAGAACAAGTCGG + Intergenic
1090223540 11:125053296-125053318 CTGTATGACACACAGGAAGTGGG + Intergenic
1090799116 11:130159797-130159819 CAGCCGGAGAAAGAGGAAGAGGG + Exonic
1095729956 12:45495460-45495482 CAGTCTGACACAAAGGATTTTGG + Intergenic
1097332147 12:58342887-58342909 CAGTGTGTCAAAGAGCATGTGGG + Intergenic
1097396731 12:59084176-59084198 AAGTCTGACAAGGATGCAGTAGG + Intergenic
1100916663 12:99431669-99431691 CATTCTGACTAAGAGGAAGGTGG + Intronic
1101289314 12:103351641-103351663 GAGTCAGACCAAGAAGAAGTCGG + Intronic
1101988897 12:109468426-109468448 CAGTCTCAGAAACAGGAAGGCGG + Intronic
1104940064 12:132390854-132390876 CAGACTGAAAAAGAGGAGGACGG + Intergenic
1105575922 13:21651808-21651830 CAGTGTGCCAATGAGGAAATTGG + Intergenic
1106488250 13:30191634-30191656 CAGTCTTACTTAGAGGAAGCTGG + Intergenic
1106752760 13:32791883-32791905 CAGTTTGAATAACAGGAAGTGGG - Intergenic
1107780943 13:43901644-43901666 CAGTCTGAAAAAAAGGAGGCTGG - Intergenic
1108109039 13:47047519-47047541 CAGTCTGAAAAAAAGAAAGAAGG + Intergenic
1108884145 13:55158138-55158160 TAGGCTGAGAAAGAGGAAGAAGG - Intergenic
1108910309 13:55541947-55541969 AAGGCTGTCAATGAGGAAGTGGG - Intergenic
1117031279 14:51673355-51673377 CAGAATCCCAAAGAGGAAGTAGG - Intronic
1121057404 14:90869927-90869949 CAGTCAGACTAACAGGAAGAAGG - Exonic
1122222718 14:100251255-100251277 TTGACTGCCAAAGAGGAAGTAGG + Intronic
1122477432 14:102020518-102020540 CAGACTGAGAAACAGGAAGAGGG - Intronic
1125524715 15:40367725-40367747 CAGATTGACGAAGGGGAAGTAGG - Exonic
1129322991 15:74784867-74784889 GAGTCTGGGAAAGAGAAAGTAGG + Intronic
1129336829 15:74857212-74857234 CAGTCTGTCGCAGAGGAGGTTGG - Intronic
1130135552 15:81178930-81178952 CAGTCAGACACAGAGGAAGCAGG - Intronic
1130867520 15:87945238-87945260 CTGTCTCACAAAAAGGAATTAGG - Intronic
1130984884 15:88838350-88838372 CAGTTTGAGAAACAGGGAGTTGG + Intronic
1133576221 16:7093410-7093432 CAGAGTGTCAAAGAAGAAGTGGG - Intronic
1134912307 16:18038638-18038660 CAGACTGAAAAATAGAAAGTGGG - Intergenic
1135175694 16:20226674-20226696 AATTCTGAAAAAGAAGAAGTGGG - Intergenic
1135627943 16:24012497-24012519 CAGTGAGACAGAGAGGAAGCAGG - Intronic
1139101877 16:63777575-63777597 CATTCTGAGAGAAAGGAAGTGGG + Intergenic
1139615838 16:68090714-68090736 CAGTATGAAAAGGAGGAAGTTGG + Intronic
1139823694 16:69740531-69740553 CTGTCAGACATAGAGAAAGTAGG - Intergenic
1140126997 16:72125794-72125816 AAGCCTCACAAAGAGGAAGCAGG + Intronic
1140745439 16:77976511-77976533 TATTCTGACAAACAGGAATTTGG - Intronic
1141926002 16:87170069-87170091 CAGCCGGAGAAAGAGGTAGTAGG + Intronic
1142720333 17:1771613-1771635 GAGGCTCAGAAAGAGGAAGTGGG + Intronic
1144424919 17:15132734-15132756 CACCCTGACAAACAGGATGTGGG - Intergenic
1146119043 17:30173569-30173591 CAGTTAGACAAAGAGGAAATAGG - Intronic
1146518976 17:33511587-33511609 CAGTGAGACAGGGAGGAAGTGGG - Intronic
1146552963 17:33797974-33797996 CAGTGTGCAAAGGAGGAAGTGGG + Intronic
1148835934 17:50465769-50465791 CAGGCTGTCGAAGGGGAAGTTGG + Exonic
1150603393 17:66670376-66670398 CAGTAACAAAAAGAGGAAGTAGG + Intronic
1160160065 18:76464365-76464387 CAGTCTCAAAAACAGAAAGTGGG + Intronic
1162333693 19:10046818-10046840 CACTCTGCCAAAGAGTAAATCGG + Intergenic
1163293369 19:16395306-16395328 CAGTCTTTCAATGAGAAAGTGGG + Intronic
1167494021 19:49807569-49807591 AAGGCTGAGAAAGAGGAAGAGGG - Intronic
1168358713 19:55719684-55719706 CTGTCAGACCAAGAGGAAATGGG + Intronic
927090410 2:19706505-19706527 CTGTCTGAAAAACAGGATGTTGG - Intergenic
927461307 2:23300680-23300702 GAATCTGACAAAGACGAAGCAGG - Intergenic
928815146 2:35284857-35284879 CAGTCTGGAAAAGAGGAAAATGG + Intergenic
928916598 2:36478547-36478569 CAGTCTGCCAGAGAGGGAGGCGG - Intronic
929058660 2:37901051-37901073 CAGTCTGTGAACCAGGAAGTGGG - Intergenic
929083670 2:38147052-38147074 GAGTCAGACAGAGAGGAGGTGGG - Intergenic
931789024 2:65646900-65646922 AAGTCAGAGTAAGAGGAAGTTGG - Intergenic
933983362 2:87571543-87571565 CAGTTTCCAAAAGAGGAAGTGGG + Intergenic
934900020 2:98152228-98152250 CAGTCTGACAACAGAGAAGTAGG - Intronic
935961248 2:108427696-108427718 TCGTCTCACAAAGGGGAAGTTGG + Intergenic
936310486 2:111379251-111379273 CAGTTTCCAAAAGAGGAAGTGGG - Intergenic
936632188 2:114215633-114215655 CATGCTGACAAAGAGGAGGGGGG - Intergenic
937257390 2:120565077-120565099 CAGCCTGGCAAAGAGGGAGTGGG - Intergenic
938803512 2:134785316-134785338 CAGTCTCACAGCGAGTAAGTGGG + Intergenic
940862572 2:158786002-158786024 CAACTTGACAAAGAGCAAGTTGG + Intergenic
942300814 2:174560400-174560422 AAGTCTGACTCAGAGAAAGTGGG - Exonic
942874582 2:180779323-180779345 CAGTCTGAAGAAGAGGAATATGG + Intergenic
942901453 2:181124759-181124781 CATTCTGTGAAGGAGGAAGTAGG - Intergenic
943629222 2:190232359-190232381 CAGACTGCCAAAAGGGAAGTAGG - Intronic
944334242 2:198510651-198510673 GAGTGAGACAAAGAGGAAGATGG - Intronic
944890128 2:204108915-204108937 CAGACTGACCTAGTGGAAGTGGG + Intergenic
947317914 2:228882055-228882077 CAATCTGCCAATGAGGAAGTGGG + Intronic
1168860948 20:1045772-1045794 CACTCTGACAGCCAGGAAGTAGG + Intergenic
1170212207 20:13856664-13856686 CTGTCTTTCAAAAAGGAAGTTGG - Intronic
1173095395 20:40023172-40023194 CAGTCTGGTAAAGAGAAACTAGG - Intergenic
1174501120 20:50985453-50985475 CAGACTGCCAAAAAGGAACTAGG - Intergenic
1174662141 20:52222561-52222583 CAGCATGCCAGAGAGGAAGTGGG - Intergenic
1175573324 20:60040567-60040589 GAGTCTGAGAGACAGGAAGTAGG + Intergenic
1175669165 20:60887006-60887028 CTGTCTCACAAGGTGGAAGTGGG - Intergenic
1178242448 21:30918294-30918316 ATGTCTGAGAAAGAGGAAGGGGG + Intergenic
1178388267 21:32174987-32175009 CATTCTGACAAATATGTAGTTGG + Intergenic
1179356416 21:40664669-40664691 CAATCTGACAAGGAAGTAGTGGG - Intronic
1180019484 21:45112604-45112626 CAGACTGACCAAGAGGAATGTGG - Intronic
1181426960 22:22849977-22849999 CAGACTGAGGAAGAAGAAGTGGG - Intronic
1181562841 22:23715627-23715649 AAGTCAGAAAAAGAGGATGTAGG + Intergenic
1182504941 22:30775194-30775216 CAGGCTGAGAGAGAGGAAATGGG - Intronic
1182520961 22:30884369-30884391 CTGTCTCACAGAGAGGATGTGGG + Intronic
1183000555 22:34855255-34855277 CAGTCTGAGAAATAGGCACTGGG - Intergenic
1183248935 22:36714603-36714625 CACTCTGAGTAAGTGGAAGTGGG - Intergenic
949319612 3:2794815-2794837 CAGTCTGTGAACCAGGAAGTAGG - Intronic
949365947 3:3280577-3280599 CAGTTTGACAGAGCGGAAGTTGG + Intergenic
952599848 3:35066952-35066974 CAGTCTGAGAAAGAGAACCTAGG + Intergenic
952698738 3:36302913-36302935 CAGGCTGACAAAGAGGATCTGGG - Intergenic
952979905 3:38726406-38726428 CAGGCAGACAAACAGGGAGTGGG - Intronic
953266492 3:41394262-41394284 CAGAAGGACAAAGAGGAAGACGG + Intronic
953743065 3:45553587-45553609 AATTCTGGCCAAGAGGAAGTGGG - Intergenic
954248002 3:49346851-49346873 AAGTCTCACAGAGAGGAAGTGGG + Intergenic
955567023 3:60258381-60258403 CATTTTGAAGAAGAGGAAGTGGG - Intronic
955808184 3:62758472-62758494 CAGTCTGACAAAGAGGAAGTGGG + Intronic
955894547 3:63685543-63685565 AGCTGTGACAAAGAGGAAGTTGG - Intergenic
957258472 3:77869808-77869830 AAGTCTAACAAAGGGGAATTTGG - Intergenic
961562346 3:127739353-127739375 CAGTAAGACACAGAGTAAGTGGG + Intronic
961647327 3:128399646-128399668 CAGCCTGACAAAGAGGTGGCTGG + Intronic
962996821 3:140636980-140637002 GAGTATGACTAAAAGGAAGTAGG - Intergenic
963445333 3:145398215-145398237 CAGTTTAACAAAGAGGTATTGGG + Intergenic
964237409 3:154548734-154548756 CAGTCAGACAAAGAGAGAGCAGG - Intergenic
965657039 3:170998337-170998359 GAAGCTGACAAAGAGGAAGATGG + Exonic
966155332 3:176910190-176910212 CAGTGTGACCAAGAGGGAGCAGG - Intergenic
966450004 3:180048308-180048330 GAGTCTCAAAAAGAGGAAGAAGG - Intergenic
966889648 3:184397790-184397812 CAGTCTGGAAAAGGGGAAGAAGG + Intronic
966921286 3:184613265-184613287 GAGTCTGAGAACGAGGAAATGGG - Intronic
967834172 3:193946882-193946904 CATTTTTACAAAGAGGAAATGGG + Intergenic
968233806 3:197019639-197019661 GAGTCTGACAAAGGAGAATTTGG - Intronic
968324267 3:197798926-197798948 CAGTATGACAGAGAGGAGGTTGG - Intronic
974331285 4:60482255-60482277 CAGTCTATCAACCAGGAAGTGGG + Intergenic
974394691 4:61319594-61319616 TAGTCTGGCAAACAGTAAGTTGG - Intronic
978291995 4:107152554-107152576 CAGTGTGAAGAAGGGGAAGTTGG + Intronic
979512953 4:121574811-121574833 CAGTCTGCAAATGAGGAAGCAGG + Intergenic
981054399 4:140345269-140345291 CAGTCTAACAAAGGAGAAGGAGG - Intronic
988968688 5:36444716-36444738 CAGTAAGAGAATGAGGAAGTGGG - Intergenic
989658573 5:43772945-43772967 CATTATGTCAAACAGGAAGTAGG + Intergenic
990166968 5:53005151-53005173 AAGTCACACAAACAGGAAGTGGG - Intronic
990535143 5:56714323-56714345 TTGTCTCACAAAGAGAAAGTTGG - Intergenic
991619734 5:68533202-68533224 GAGTCGGGGAAAGAGGAAGTAGG + Intergenic
992523510 5:77582348-77582370 CAGCCGGAAAAAGAGGAAGTTGG - Intronic
993269187 5:85771460-85771482 CAGTCTGACAAAGAGCTACAGGG + Intergenic
995096653 5:108243640-108243662 CAGTTTGACAAAACGGAAGAAGG - Intronic
995387669 5:111606027-111606049 AATTCAGAAAAAGAGGAAGTAGG - Intergenic
995922286 5:117328718-117328740 CAGTCTGACAAATTGCAAATGGG - Intergenic
997944387 5:138186275-138186297 TATTCTGAAAAAGGGGAAGTAGG - Exonic
999845460 5:155474700-155474722 CAGTCTGAGAAAGAGAAAAAAGG - Intergenic
1001274925 5:170343643-170343665 CTGTCCGACAATGAGGAGGTGGG + Intergenic
1003048312 6:2756454-2756476 CATTCTGCCTAAGAGGAAGGAGG - Intergenic
1004315735 6:14585766-14585788 CTCTCTGACACAGAGGAACTAGG - Intergenic
1006010301 6:31037494-31037516 AAGTCTGGGAAAGAGGAAGGTGG - Intergenic
1006017539 6:31094288-31094310 CAGGCAGAGAAAGAGGAGGTGGG + Intergenic
1006189191 6:32197204-32197226 GAGTTTGACAAGGAGGAAATTGG - Intronic
1007705938 6:43791471-43791493 GAGTCTTACCAAGAGAAAGTGGG + Intergenic
1009473883 6:64063053-64063075 GAGTCTGACAAGGAGTAAGTAGG - Intronic
1010013447 6:71076271-71076293 GAGTCTGAGAAAGATGAACTTGG + Intergenic
1010963775 6:82178821-82178843 CAGTCTGTCAAAGAGTAAGGAGG + Intronic
1013146617 6:107400431-107400453 CAGTCCCACAAAGAGGGAATTGG - Intronic
1013593951 6:111644701-111644723 CATTCTGACAAGGATGAGGTAGG + Intergenic
1014294952 6:119606688-119606710 AAGTCTGACAATGAGGAAGATGG + Intergenic
1016380602 6:143474499-143474521 TAGTCAGACAAAGAAGAAATAGG - Intronic
1017242606 6:152187557-152187579 CACTCTGACAAGGTGGCAGTTGG - Intronic
1018074844 6:160202626-160202648 CAGGCTGACCAAGAGTAGGTTGG + Intronic
1018494898 6:164338702-164338724 TAGTCTGTCAAACAGGAAGCAGG + Intergenic
1018647797 6:165964143-165964165 CAGGCTGATAATGAAGAAGTGGG - Intronic
1022281981 7:28920270-28920292 TAGTCTGATAAAGAAGAACTGGG + Intergenic
1023452290 7:40300336-40300358 CAGTCTGGCGAAAAGGAATTTGG - Intronic
1024204254 7:47142375-47142397 GAATCTGACAAAGAGGAATGAGG + Intergenic
1024405683 7:48976593-48976615 CAGTCTGACTCTGAGGAAGGTGG - Intergenic
1027132234 7:75599244-75599266 CAGTCTGAAAAACAAGAAGGGGG + Exonic
1028264935 7:88711491-88711513 CACTCTGACAAACAGAAAGCTGG - Intergenic
1029354384 7:100040686-100040708 CAGGCTGAGAAAGAGTAATTAGG + Exonic
1031309693 7:120180362-120180384 AAGTCTGAAAAAGTGGAAGCTGG + Intergenic
1033572093 7:142640406-142640428 CAGTCTGACAAAGAGGTCCCTGG + Intergenic
1036491737 8:9232890-9232912 CAGTTGGGGAAAGAGGAAGTAGG + Intergenic
1038651582 8:29408600-29408622 CTGTTTGACACTGAGGAAGTTGG + Intergenic
1039193391 8:35002512-35002534 CAGTCTCAGCAAGTGGAAGTGGG - Intergenic
1039698639 8:39940113-39940135 CTTTCTTACTAAGAGGAAGTTGG - Intronic
1039724483 8:40201127-40201149 CAGTCTGAAAAAAATGAATTTGG - Intergenic
1039922069 8:41900204-41900226 CAGGCTGAGAAAGAGAAAGTGGG + Intergenic
1040438132 8:47413309-47413331 CAATCTGCCAAAGAGGAGCTTGG - Intronic
1041080713 8:54212539-54212561 AAGTGAGACATAGAGGAAGTGGG + Intergenic
1041208756 8:55525043-55525065 CAGGTACACAAAGAGGAAGTGGG + Exonic
1042350968 8:67777349-67777371 CAGACTGCCAAAGAGGTAGGTGG + Intergenic
1042858721 8:73293618-73293640 CAGCCGGAAAAAGAGGAAGTTGG + Exonic
1043487971 8:80717557-80717579 CAGATTGGCAAAGAGGAAGAGGG - Intronic
1045290395 8:100827841-100827863 CAGTGTCCCAAAGAGGAAGCTGG + Intergenic
1046867711 8:119169621-119169643 CAGACTTATAAAAAGGAAGTAGG - Intronic
1047636371 8:126767600-126767622 CAGCCTGAGCAGGAGGAAGTTGG - Intergenic
1051221662 9:14855185-14855207 GAGACTGACAAAGAATAAGTAGG + Intronic
1051682981 9:19626925-19626947 CCATCTGACTAAGAGGTAGTAGG - Intronic
1052884588 9:33632284-33632306 CAGTCTGACAAAGAGGTCCCTGG + Intergenic
1053157047 9:35788669-35788691 CAGTGCTACAAAGAGAAAGTTGG + Intergenic
1053303627 9:36969059-36969081 CCTTCTGACAAGGAGGAACTTGG - Intronic
1053366802 9:37528567-37528589 CATTCTGACTAGGAGGATGTGGG - Intronic
1055959857 9:81809982-81810004 GAGACTGATCAAGAGGAAGTTGG + Intergenic
1056527574 9:87457501-87457523 CAGCCATACAAAGAGGAAGGAGG + Intergenic
1056853340 9:90103213-90103235 CAGTCTGTGAACCAGGAAGTGGG + Intergenic
1057278517 9:93692115-93692137 CAGTCTGTGAATCAGGAAGTGGG + Intergenic
1057772660 9:97982756-97982778 CAGTCTGCCAAGGAGGCAGCGGG + Intergenic
1060396939 9:123322876-123322898 CTGGCAGACAGAGAGGAAGTGGG + Intergenic
1185597436 X:1316311-1316333 CAGACAGACAGAGAGGTAGTTGG + Intergenic
1186089299 X:6027195-6027217 CATTCTGACAAAGAGGTGGAAGG - Intronic
1187538378 X:20165271-20165293 CAGTTGGACAAAGAGGAGGGAGG - Intronic
1188315034 X:28662913-28662935 CATTCTGACTATGAGAAAGTAGG - Intronic
1188456144 X:30368641-30368663 GAGCCTGAAAGAGAGGAAGTGGG + Intergenic
1189204615 X:39227003-39227025 GGGCCTGACAAAGAGCAAGTAGG + Intergenic
1192481375 X:71489249-71489271 CAGTATCACAAAGAGGCAGAGGG - Intronic
1194937110 X:99964142-99964164 CAGAATGTCAAAGAGGAATTGGG + Intergenic
1195264428 X:103166101-103166123 CCGTCTGACAAAAAAGAAGCAGG - Intergenic
1197492817 X:127139647-127139669 CAGACTGACAAAGAGCTACTTGG + Intergenic
1197921325 X:131597443-131597465 CAGTATGAAAAAAAGCAAGTTGG + Intergenic
1198652902 X:138883266-138883288 CTGGCTGACAGAGATGAAGTTGG - Intronic
1199420688 X:147640955-147640977 AAGTCTTACAAACAGGAAGGGGG + Intergenic