ID: 955811069

View in Genome Browser
Species Human (GRCh38)
Location 3:62790243-62790265
Sequence CAGAGATACTACTATAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955811069_955811071 -7 Left 955811069 3:62790243-62790265 CCAACTTTATAGTAGTATCTCTG 0: 1
1: 0
2: 0
3: 17
4: 151
Right 955811071 3:62790259-62790281 ATCTCTGAATAACTGGATTGTGG 0: 1
1: 0
2: 1
3: 15
4: 166
955811069_955811072 -6 Left 955811069 3:62790243-62790265 CCAACTTTATAGTAGTATCTCTG 0: 1
1: 0
2: 0
3: 17
4: 151
Right 955811072 3:62790260-62790282 TCTCTGAATAACTGGATTGTGGG 0: 1
1: 0
2: 1
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955811069 Original CRISPR CAGAGATACTACTATAAAGT TGG (reversed) Intronic
901268390 1:7930476-7930498 CAGAGATACTCCTTTAAATCAGG + Intronic
909341569 1:74537954-74537976 CAGTGATACAACTATAAAATGGG - Intronic
909661577 1:78089333-78089355 CCCAAATAATACTATAAAGTAGG - Intronic
910326738 1:86017490-86017512 CAGAGATAAGACAATAAAGCTGG + Intronic
910359502 1:86401202-86401224 ATGAAATACTACTATATAGTAGG - Intergenic
911054341 1:93697601-93697623 CAGAGAGAATACTATACAATTGG + Intronic
911872431 1:103116050-103116072 CAGAAATATTGCTACAAAGTAGG - Intergenic
911979046 1:104542864-104542886 CAAAGAAACAACTAAAAAGTTGG + Intergenic
912383901 1:109261879-109261901 CTGAAATACTACAATAAGGTGGG + Exonic
913570790 1:120118093-120118115 CAGACTTACTAAAATAAAGTAGG - Intergenic
914291595 1:146279069-146279091 CAGACTTACTAAAATAAAGTAGG - Intergenic
914552639 1:148729852-148729874 CAGACTTACTAAAATAAAGTAGG - Intergenic
918409322 1:184242297-184242319 CAGAGATAGTGCTAAAAGGTTGG - Intergenic
919104636 1:193133981-193134003 CAGATATTCTACTATATTGTTGG + Intronic
921923369 1:220691634-220691656 CAGGGGTAAAACTATAAAGTTGG + Intronic
922439385 1:225640357-225640379 CAGAGATAATAGTACATAGTTGG - Intronic
924897143 1:248351919-248351941 CATTGATACAACTATAATGTTGG + Intergenic
1067700577 10:48568594-48568616 CAGAGAAAATACTAAAAAGTGGG - Intronic
1068066909 10:52143384-52143406 GAGGGATACTACTATTTAGTGGG - Intronic
1073364083 10:102923088-102923110 CACATATACTAATATAAAGGTGG - Intronic
1078387160 11:10902752-10902774 CTCAGAAACTACTATAAAGGGGG + Intergenic
1078753694 11:14188699-14188721 CAGAGTCACTACTAGAAAGCGGG - Intronic
1080480846 11:32648272-32648294 CAGTAATAGTACTAAAAAGTGGG - Intronic
1081724352 11:45317372-45317394 CAGAGAGACTAGTCTAGAGTTGG - Intergenic
1081925527 11:46824583-46824605 CAGACATACTAGTATTCAGTTGG - Intronic
1082728633 11:56767944-56767966 GAGAGATTCTAATATAAAGATGG + Intergenic
1085062542 11:73460841-73460863 CTGAGTTTCTTCTATAAAGTAGG - Intronic
1087434808 11:98101233-98101255 CAGACACACTAATATAAAGGAGG + Intergenic
1090467531 11:126948322-126948344 CTGAGATCCCTCTATAAAGTTGG - Intronic
1093667909 12:21836183-21836205 CTGGGATACTACTATGAACTGGG - Intronic
1093994256 12:25624615-25624637 TAGAGTCACTACTATAAACTGGG + Intronic
1094407754 12:30136471-30136493 AAGAGATACTACTGGAATGTAGG - Intergenic
1096025423 12:48356808-48356830 CAGAGACAGTACTAGAAGGTAGG - Intergenic
1097512905 12:60565635-60565657 CACAGATGCTAGTATAAAGGGGG - Intergenic
1097687329 12:62703316-62703338 CAGAGATAATAATCTAAAGAAGG + Intronic
1100063223 12:90607813-90607835 CAGAGATAGTACCTAAAAGTTGG + Intergenic
1105439084 13:20401081-20401103 CTGAGCTACTACTAAAAAATAGG - Intergenic
1106442386 13:29788109-29788131 AAGAGAAAGTACTATATAGTAGG - Intronic
1107897467 13:44980060-44980082 CAGAGATAATACTATACAGATGG - Intronic
1109627039 13:64988320-64988342 CAGACATAATTCAATAAAGTTGG - Intergenic
1111451119 13:88418319-88418341 TAGTGCTACCACTATAAAGTGGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112395336 13:99025250-99025272 CACATATACTATTATAAAATTGG + Intronic
1112550260 13:100413200-100413222 CACAGATAATAATATAAAGTAGG + Intronic
1115040804 14:28924046-28924068 AAGAAATGCTAGTATAAAGTAGG + Intergenic
1116135026 14:40911541-40911563 CAAAGAAACTTCTATAAGGTAGG + Intergenic
1117767326 14:59096747-59096769 AAGAGACACTTCTATTAAGTTGG + Intergenic
1117931198 14:60842271-60842293 CAGAGAAAAAACTCTAAAGTGGG - Intronic
1118099549 14:62581192-62581214 CAGAGATCCAACTTTAAAGTGGG - Intergenic
1120253338 14:82087921-82087943 CAGAGAAACAACAAAAAAGTAGG - Intergenic
1120370332 14:83626082-83626104 GAGAGATATTTCTATAAAGGGGG + Intergenic
1123207687 14:106728753-106728775 CAGAGAGCTTACTATATAGTAGG - Intergenic
1125763979 15:42120722-42120744 CAGAGCTGCTGCTATACAGTGGG - Intergenic
1126462270 15:48926757-48926779 CAGAAATACTATTATACAGCAGG - Intronic
1126975647 15:54176252-54176274 TAGAGATGCTACTAAAAAGTGGG - Intronic
1127146934 15:56034590-56034612 CAGAGATACTACTAGAAACCAGG - Intergenic
1130831820 15:87608702-87608724 CAGATTTTCCACTATAAAGTGGG - Intergenic
1131700705 15:94932804-94932826 CACATATACTACTATAAAAATGG + Intergenic
1134897562 16:17902675-17902697 GAGAGATAGTGCCATAAAGTGGG - Intergenic
1136283536 16:29228436-29228458 CAGAGAAACTACTCCCAAGTGGG - Intergenic
1138985962 16:62328830-62328852 CAATGATACTACAATAAAGCTGG - Intergenic
1142087960 16:88194386-88194408 CAGAGAAACTACTCCCAAGTGGG - Intergenic
1144531493 17:16043573-16043595 GAGAGAAAAAACTATAAAGTAGG + Intronic
1149811363 17:59676642-59676664 CAGTGATCCTATTATAAATTGGG - Intronic
1149937736 17:60825826-60825848 CAGAGATAGTATTAAGAAGTGGG - Intronic
1155466068 18:26136731-26136753 CAGAGATCTTACTATCCAGTTGG - Intronic
1155725991 18:29083998-29084020 CATACATACTATTATATAGTAGG - Intergenic
1156228856 18:35134859-35134881 CAGAGATACAACAACAAAGTGGG - Intronic
1156905424 18:42346987-42347009 CTGCCATACTACTGTAAAGTAGG + Intergenic
1158762707 18:60409465-60409487 GAGAGAGACTAGTAGAAAGTAGG + Intergenic
1159253703 18:65916985-65917007 GAGAGACACTACTATAAAGAAGG - Intergenic
1165926778 19:39331347-39331369 CAAAGATAAAACTATAAAGAAGG + Intronic
925951460 2:8916273-8916295 TTCAGATACTACTATAAATTGGG + Intronic
927729157 2:25455168-25455190 CAGACATTCTCCTTTAAAGTGGG - Intronic
928241950 2:29594220-29594242 CATAGATACTAGTAAATAGTTGG - Intronic
930436184 2:51346099-51346121 CAAAGAGTCTACTATAAAGTAGG + Intergenic
930690762 2:54361726-54361748 TAGGTATACTACTATAAAATTGG + Intronic
933026852 2:77270885-77270907 CAAAGACACAACTCTAAAGTGGG - Intronic
933608898 2:84413895-84413917 TTGAGATACTACTATACAGTAGG - Intergenic
938365589 2:130730672-130730694 TGGAGATACCACTATAAAGCTGG + Intergenic
938914898 2:135928260-135928282 CAGAGATACTACTGTGAAGCTGG + Intronic
939172867 2:138715895-138715917 CAGAGAGGCTACTATATAGCTGG - Intronic
939806982 2:146785996-146786018 GAGAGAAAATACTATAAACTTGG - Intergenic
941964031 2:171283116-171283138 GTGAGATACAACTATAAATTTGG - Intergenic
943735314 2:191347709-191347731 CAGAGAAACTGCTAAAAACTGGG - Intronic
945471749 2:210234992-210235014 CAGAGTTCCTCCCATAAAGTTGG + Intergenic
946603770 2:221379526-221379548 CAAAGATACATCTATAAAGTCGG - Intergenic
948088350 2:235268888-235268910 CTCAGATACTACTTTAAAGGTGG + Intergenic
1171137707 20:22711845-22711867 CAGAGATACTTCTGTGAAGCAGG + Intergenic
1172025252 20:31943974-31943996 CAGAGAAACTACTCTGAAGCAGG - Exonic
1173428692 20:42966557-42966579 CAGAGTTTCTACTATAAGTTGGG - Intronic
1173710259 20:45149401-45149423 CAGAGATACTACAAGGCAGTAGG + Intergenic
1177897201 21:26867873-26867895 AAGAGATAATTCTAGAAAGTAGG - Intergenic
1178143167 21:29707242-29707264 CACACATACAACTATAAATTGGG + Intronic
1181083488 22:20428783-20428805 CAGAGATCCTCCTGGAAAGTGGG - Intronic
1181094907 22:20498097-20498119 GTGCGATACTATTATAAAGTAGG + Intronic
1182816697 22:33170796-33170818 CAGTGGTACTGCTATAAAGTGGG + Intronic
1183900565 22:41002842-41002864 CAGAGATACTATTAAAATATAGG - Intergenic
1184743199 22:46441167-46441189 AAGAGAGACTGCTATAAAGATGG + Intronic
951362678 3:21743129-21743151 AAGAGATACAACTGTAAAGTAGG + Intronic
952612051 3:35223166-35223188 CTGAGAAACTACTATGAAATAGG + Intergenic
954150598 3:48655301-48655323 CTGAGATACTACAACAAGGTGGG - Exonic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
954981451 3:54749615-54749637 AAGAGATTTTACTTTAAAGTAGG - Intronic
955511224 3:59682377-59682399 AAGAGATACTACAAATAAGTAGG + Intergenic
955811069 3:62790243-62790265 CAGAGATACTACTATAAAGTTGG - Intronic
956922881 3:73949478-73949500 CATAGAGACTTCTTTAAAGTTGG - Intergenic
960523617 3:118683656-118683678 CAAAGATACTACAATAAATATGG + Intergenic
961723416 3:128910453-128910475 CAGAGATCCTGGTATACAGTGGG - Intronic
963886860 3:150592869-150592891 GAGAGATACTGCAATTAAGTGGG + Intronic
964949011 3:162263866-162263888 CAGAGACAGTACTAAAAAGAGGG + Intergenic
967474227 3:189896836-189896858 CATAGAAACCACTAGAAAGTGGG + Exonic
969111650 4:4848246-4848268 CAGAGATAATAATAAAATGTTGG + Intergenic
969536436 4:7758819-7758841 CAGTGAAGCTACTACAAAGTGGG + Exonic
969839861 4:9873271-9873293 CTGAGAGCCTACTAGAAAGTGGG - Intronic
970138956 4:12959046-12959068 CTGAGATATTACTCTAATGTGGG - Intergenic
970360785 4:15307017-15307039 CATAGATACAATTATGAAGTTGG + Intergenic
974623486 4:64391653-64391675 TAGAGATCCTAGTATATAGTAGG + Intronic
976325300 4:83764081-83764103 CACAGAGGCTACTATGAAGTGGG - Intergenic
978167208 4:105623752-105623774 CAGAGTTACTAATATAAATTGGG - Intronic
978229644 4:106383820-106383842 CAGAGATAATTCTAGAACGTGGG + Intergenic
978995861 4:115151626-115151648 CAGACAAACAACTATAAAGAAGG + Intergenic
979852176 4:125586464-125586486 CATAGACACTGCTGTAAAGTTGG - Intergenic
980263515 4:130485132-130485154 AAGAGATAAGACTATAAATTGGG + Intergenic
980826910 4:138084572-138084594 CAGAGATACTTGTATAAACCTGG + Intergenic
981587982 4:146324977-146324999 TAGATATACTACTAAACAGTTGG - Intronic
990812410 5:59743097-59743119 CAGTGATTATTCTATAAAGTGGG + Intronic
992880879 5:81108457-81108479 CAGAGGTACTAGTAAAATGTGGG + Intronic
994198553 5:96946126-96946148 CAGAGAAACTACTAATAAGAGGG - Intronic
995011239 5:107259234-107259256 TAGAGATACTACTCAAAACTGGG + Intergenic
996659195 5:125979733-125979755 AAGATATACTATTATAAACTAGG - Intergenic
999629852 5:153559696-153559718 CAGAGATATTACTAGACAATAGG + Intronic
999636805 5:153631570-153631592 CAGAGAGACGACTCTAAGGTTGG + Intronic
1000941677 5:167369597-167369619 AAGAGATACTAGGAGAAAGTGGG + Intronic
1010345865 6:74810126-74810148 CAGAGATACTTAAATATAGTAGG - Intergenic
1010571025 6:77474921-77474943 CAGAGATACTACTCCATAGAAGG + Intergenic
1010929471 6:81783356-81783378 CCTAGATACTACTAGAAAGGTGG + Intergenic
1012405030 6:98886212-98886234 CAGAGTCACTAGTATATAGTAGG + Intronic
1013262988 6:108464911-108464933 GTGGGATGCTACTATAAAGTAGG - Intronic
1014121655 6:117732801-117732823 AAGAAGTATTACTATAAAGTGGG - Intergenic
1014341723 6:120216782-120216804 CAGAGATACAATTATAATATAGG + Intergenic
1018305432 6:162449802-162449824 CAAAAAAACTACTATAAAATTGG + Intronic
1020490639 7:8779687-8779709 CAGAGATTCTAATATAAGGATGG - Intergenic
1021593083 7:22285857-22285879 CAGAGATCCCACAAGAAAGTTGG + Intronic
1022843281 7:34185046-34185068 CAGAGATAATTCTATTAGGTTGG + Intergenic
1023171500 7:37394125-37394147 CAGGGACACTAATATAATGTTGG + Intronic
1028033338 7:85947266-85947288 AAGAGATACAACTAGAAATTAGG - Intergenic
1030382311 7:108826235-108826257 AAGAGATCCTAATACAAAGTAGG - Intergenic
1031383927 7:121122540-121122562 CAAGGATACCTCTATAAAGTAGG + Intronic
1031721664 7:125184255-125184277 CATCTATACTACTTTAAAGTTGG + Intergenic
1033853826 7:145532677-145532699 AAAAGATAAAACTATAAAGTTGG + Intergenic
1035817291 8:2554844-2554866 CAGAGATACCCCTAGAAAGCTGG - Intergenic
1040768751 8:50948276-50948298 AAGTGAGACTACTATAAACTTGG - Intergenic
1047796215 8:128258263-128258285 TAGAGAAATCACTATAAAGTAGG - Intergenic
1047898720 8:129396867-129396889 CAGAAATACTACCAATAAGTGGG + Intergenic
1052865364 9:33461784-33461806 CAGAGAGGCTACCAGAAAGTGGG + Exonic
1053026528 9:34733960-34733982 CAGAGATTCAACTACAAAATAGG + Intergenic
1055113240 9:72580252-72580274 AAGAGATAAGACTATATAGTAGG - Intronic
1058993970 9:110281455-110281477 CAGAGGTGAAACTATAAAGTCGG + Intergenic
1187284798 X:17894724-17894746 AAGGGGTACTACTAAAAAGTAGG - Intergenic
1188115387 X:26237280-26237302 CAAAGATACTACTATCATGATGG + Intergenic
1188793086 X:34428484-34428506 TTGAGGTACTATTATAAAGTAGG + Intergenic
1193616222 X:83691303-83691325 ACGAGATATTACTATAAACTAGG + Intergenic
1195643367 X:107202073-107202095 CAGAGATACTTTTCCAAAGTTGG - Intronic
1196155319 X:112422240-112422262 TAGAGTGACTACTATAAAATAGG + Intergenic
1197412950 X:126140873-126140895 TAGAGATACCAATATAAAGAGGG - Intergenic
1198831967 X:140760317-140760339 CAGACATAGGGCTATAAAGTAGG + Intergenic
1199158085 X:144573230-144573252 CTGAGAGGCTACTATAAACTAGG + Intergenic
1200755567 Y:6986968-6986990 ATGAGATAACACTATAAAGTGGG - Intronic