ID: 955811442

View in Genome Browser
Species Human (GRCh38)
Location 3:62794961-62794983
Sequence CAGAGCGCTATGGGTTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955811437_955811442 15 Left 955811437 3:62794923-62794945 CCTGTGGCGGGCTCTCATTCAGA 0: 1
1: 0
2: 0
3: 2
4: 62
Right 955811442 3:62794961-62794983 CAGAGCGCTATGGGTTCTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 61
955811436_955811442 26 Left 955811436 3:62794912-62794934 CCAGTAATTATCCTGTGGCGGGC 0: 1
1: 0
2: 0
3: 2
4: 35
Right 955811442 3:62794961-62794983 CAGAGCGCTATGGGTTCTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955811442 Original CRISPR CAGAGCGCTATGGGTTCTCA GGG Intronic
900871972 1:5310793-5310815 CAGAGTGCTATGGGGACTCCTGG - Intergenic
908589255 1:65611917-65611939 CAAAGCTCTATGGGTTCTTTAGG + Intronic
912021399 1:105112159-105112181 CAGAGTGCAATGGGTTCTCTGGG + Intergenic
913546128 1:119871047-119871069 CAGAGCCCTAGGGGTCCTCCTGG - Intergenic
1066491818 10:35901491-35901513 CACTGCACTATGGGGTCTCATGG - Intergenic
1067720590 10:48724995-48725017 CAGAGAGCTGAGGGTTGTCAGGG + Intronic
1072378822 10:94844999-94845021 CCTTGCGCTCTGGGTTCTCAGGG - Intronic
1073036649 10:100568490-100568512 TGGAGCTCTAAGGGTTCTCAGGG - Intergenic
1079612101 11:22445837-22445859 CAGAGAACTATGGGTGCTTACGG + Intergenic
1084569419 11:69950482-69950504 TTGAGCACTGTGGGTTCTCAGGG + Intergenic
1090032552 11:123219625-123219647 CAGAGCCTTGTGGGCTCTCAGGG - Intergenic
1091505875 12:1067578-1067600 CAGAGGGCCATGAGTGCTCAGGG + Intronic
1096618776 12:52849379-52849401 CAGAGTGCCCTGGATTCTCAAGG + Intergenic
1107860384 13:44655011-44655033 CAGAGAGCTATGGGTTATGAAGG + Intergenic
1123948733 15:25251330-25251352 CAGAGAGGTATGGGTTCTCCAGG + Intergenic
1130139196 15:81209365-81209387 CAGAGGGATATGGGCTCGCAGGG + Intronic
1130141417 15:81229369-81229391 CAGAGGGATATGGGCTCGCAGGG + Intronic
1130509794 15:84580095-84580117 CAGAGAGTTCTGGTTTCTCAAGG - Intergenic
1130585377 15:85176666-85176688 CAGAGAGTTCTGGTTTCTCAAGG + Intergenic
1132229055 15:100168380-100168402 CAGAGCGCTGTCAGTTATCATGG + Intronic
1149114603 17:53077541-53077563 AAAACCGCTTTGGGTTCTCATGG - Intergenic
1162779543 19:12999810-12999832 CAGAGAGCTATAGCTTCGCAGGG - Intronic
1165170212 19:33887164-33887186 CAGAGCTCTGTGCGTTCACAGGG - Intergenic
927092780 2:19725011-19725033 GAGAAAGCTAGGGGTTCTCAGGG + Intergenic
932012773 2:67994687-67994709 GAGAGTGCTGTGGGTTCCCACGG + Intergenic
933484274 2:82897590-82897612 CAGAGCGCTAAGGGGTAGCATGG + Intergenic
933834975 2:86238683-86238705 CAGAGGGCTGTGGGTGCACAGGG + Intronic
938231922 2:129668945-129668967 CAGAGCACCATGGGTAGTCAGGG - Intergenic
939342235 2:140913367-140913389 GAGAGTGCTATGGATTTTCAAGG + Intronic
941974215 2:171385713-171385735 CAGAGCCCTAAGGGTCCTCTTGG + Intronic
942180310 2:173374076-173374098 CAGAAAGCAATAGGTTCTCATGG - Intergenic
1168964835 20:1893090-1893112 CAGAACCCTGTGGGTTCTCAAGG + Intergenic
1171396822 20:24839928-24839950 CAGATCACTGTGGGTTCTCCAGG - Intergenic
1173441981 20:43085884-43085906 CAGAGCGCTAAGGATCCTAAGGG + Intronic
1177206641 21:18017885-18017907 CAGAGCGGTATTGCTGCTCAAGG + Intronic
1177874725 21:26618204-26618226 CAAAGTGCTATGGGTGCTCAGGG - Intergenic
1182005626 22:26957128-26957150 CTGGGCTCTCTGGGTTCTCATGG - Intergenic
1183512480 22:38244171-38244193 CTGTGCCCTATGAGTTCTCAGGG + Intronic
951041723 3:17995306-17995328 CAGACAGCTATGGGTGGTCATGG + Intronic
952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG + Exonic
953201065 3:40779216-40779238 AAGAGGGCCATGGGATCTCAGGG - Intergenic
955811442 3:62794961-62794983 CAGAGCGCTATGGGTTCTCAGGG + Intronic
955939692 3:64135749-64135771 CAGAGCTATCTGGGTGCTCAAGG + Intronic
966820512 3:183920649-183920671 CAGAGCGCCGTGAGTTCTCAGGG - Exonic
969311254 4:6354085-6354107 CAGAGCGCAAGGGGTTCAGATGG - Intronic
973259428 4:48146882-48146904 CAGAGTGCTATGGGTGTTTATGG - Intronic
973529496 4:51820683-51820705 CAGACCTCTATGGGCTCCCATGG - Intergenic
978850915 4:113335375-113335397 CATAGCCCTTTGGGTTTTCAGGG - Intronic
986227051 5:5825720-5825742 CAGAGGTCTCTGGGTGCTCATGG - Intergenic
988844377 5:35113749-35113771 CTGCCCGCTATGGGTTCTCATGG - Intronic
994051433 5:95366347-95366369 CAGAGCGCTGTGGGTTCTCTTGG + Intergenic
995452061 5:112313195-112313217 CATAGCCCTAGGGCTTCTCAGGG - Intronic
997929529 5:138060853-138060875 CAGAGCTGGATGGGATCTCAGGG + Intergenic
1003031068 6:2600966-2600988 AAGAGCTCTCTGGGTTCTCTTGG - Intergenic
1006341139 6:33447767-33447789 CAGAGAGCTATGGGGTTCCATGG + Intronic
1015218746 6:130780384-130780406 CAGAGGGCTGTGGCTTCCCACGG - Intergenic
1018103184 6:160459237-160459259 CAGAGGGCTCTGGGGCCTCAAGG - Intergenic
1020259074 7:6520604-6520626 CTGAGCGCTATGGGGTCTGCCGG - Exonic
1022807480 7:33837339-33837361 CAGTGCTGGATGGGTTCTCATGG + Intergenic
1030337281 7:108340772-108340794 CAGAGAGGTATGCTTTCTCAAGG - Intronic
1040376297 8:46827989-46828011 CAGAGAATTTTGGGTTCTCAGGG + Intergenic
1044858129 8:96495498-96495520 CAGTGCCCTCTGGGGTCTCAGGG + Intronic
1045560662 8:103259204-103259226 CAGTGGGCTATTGGTTTTCAAGG - Intergenic
1047509244 8:125503824-125503846 AAGAGCGCTATGAGGTCTCTGGG + Intergenic
1047547475 8:125833038-125833060 CAGAGCCCTCGGGTTTCTCAGGG - Intergenic
1053916886 9:42950314-42950336 CAGAGCACCAAGGGTTCTCTTGG + Intergenic
1057924726 9:99134862-99134884 CAGAGAGCTATGGTCCCTCATGG - Intronic
1189617109 X:42795102-42795124 CAGAGCGCTATTGTTAATCATGG + Intergenic
1191991666 X:67043841-67043863 CAAAGTGCTATGGGATCTCTGGG + Intergenic
1193681068 X:84519126-84519148 GAAAGCCCTATGGGTTCTCTGGG - Intergenic