ID: 955813041

View in Genome Browser
Species Human (GRCh38)
Location 3:62811419-62811441
Sequence CCAATGCATGCATTTTCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955813041 Original CRISPR CCAATGCATGCATTTTCTTG AGG (reversed) Intronic
902687607 1:18089083-18089105 CCATTTCATGCACTTCCTTGTGG - Intergenic
906827255 1:48994597-48994619 GAAATACATGCAGTTTCTTGGGG - Intronic
907835276 1:58102865-58102887 CCAATTTTTGCATTTTCCTGAGG - Intronic
907850220 1:58248964-58248986 CCAATGAATGCATTTTAGTTTGG - Intronic
908266981 1:62389195-62389217 ACAATACATGCATTTTATTTGGG + Intergenic
910653384 1:89593944-89593966 CAAATGCAGGCATTTTCTCAGGG - Exonic
910838396 1:91538372-91538394 TCAATGGTTGCATTTTCTTTGGG + Intergenic
910892899 1:92036093-92036115 CCGATGCATGAATTTTATTTAGG - Intronic
911212224 1:95154279-95154301 CCAATCCATTCACTTCCTTGGGG + Intronic
912183061 1:107241678-107241700 CCAATGACTGCATTTTCTTGAGG - Intronic
913335357 1:117704515-117704537 CCAATACCTGCAAGTTCTTGTGG + Intergenic
915092617 1:153437084-153437106 CCACTCCATGCATTATCTTGTGG + Exonic
916790925 1:168124534-168124556 CTAATGGAAGCATTTTCTTTTGG + Intronic
918222050 1:182444214-182444236 CCAAAGGATGCATTTGCTTTAGG - Intergenic
918906550 1:190503774-190503796 CCCATGCAAGCATTTTCTTTTGG - Intergenic
919658870 1:200223713-200223735 CCAAAGCCTGGACTTTCTTGTGG - Intergenic
920424184 1:205860368-205860390 CCAATGGATGCCTTTTGTTTTGG - Intergenic
922458676 1:225797990-225798012 CCAATGGATGCCTTTTGTTTTGG + Intergenic
924677917 1:246199419-246199441 CAAATGAATGCATCTGCTTGTGG + Intronic
1063319300 10:5037709-5037731 CCAATGGATGCATTTTGCTTAGG - Intronic
1064538238 10:16379849-16379871 CCAAGGCAGGCAATCTCTTGAGG - Intergenic
1064553693 10:16527216-16527238 CTAATGCAGGCAGTCTCTTGGGG + Intergenic
1065933698 10:30501396-30501418 AAAATACATGTATTTTCTTGGGG + Intergenic
1067969368 10:50952421-50952443 CCATTGCATGCATGTTCCTATGG + Intergenic
1069613886 10:69793807-69793829 CTAATGGCTGCATTTGCTTGTGG + Intergenic
1071802142 10:89075541-89075563 TTAATGGATGCATGTTCTTGTGG - Intergenic
1072275334 10:93817049-93817071 CCCCTGCTTGCATTTTCTTCAGG + Intergenic
1072914864 10:99531485-99531507 CCAATCCAAGCATTTTTTGGCGG - Intergenic
1074084414 10:110196999-110197021 CAAATGCATGCATTTTCTTAGGG + Intergenic
1075214340 10:120519107-120519129 CCACTGACTGCACTTTCTTGTGG + Intronic
1076018879 10:127053679-127053701 CCAATTTATGTATTTTATTGAGG - Intronic
1078622746 11:12923873-12923895 CCAATGCATGAATTTGGTGGGGG + Intronic
1079054489 11:17194010-17194032 CCAAAGCCTGCATCTTCTTTAGG - Intronic
1080549337 11:33357875-33357897 CATATGCATGCATTTCCTTTGGG + Intergenic
1080634368 11:34110488-34110510 CCAATGGATGCTTTTGCTTTAGG + Intronic
1080852940 11:36086793-36086815 CTACTGCATGCATTCTCTTCAGG + Intronic
1081413537 11:42787220-42787242 CAAATGCCTGCAATTTCCTGTGG - Intergenic
1082281366 11:50274464-50274486 CCTGTGCATGCATTTGTTTGGGG + Intergenic
1083810558 11:65103275-65103297 CCATTGCCTGCATTTTGTTGGGG - Intronic
1087145203 11:94803604-94803626 CAAATGCTTGCCTTTGCTTGGGG - Intronic
1087801686 11:102511295-102511317 CCAATTTATGCATTTTCTTAAGG - Intergenic
1091350892 11:134893136-134893158 CCAATGCAGGCATTTCCTCAGGG + Intergenic
1092345438 12:7710770-7710792 CAAATACAAGCATTTTTTTGTGG + Intergenic
1095373875 12:41503147-41503169 TCAATGCTTGCATTTTCTAAGGG + Intronic
1097451573 12:59742943-59742965 CAGATGCATGCAATTTCTTGTGG - Intronic
1097867585 12:64571746-64571768 CCAATGCATACATTTAAATGGGG + Intergenic
1098521725 12:71440588-71440610 CAAATGCAGGCATTTGCGTGCGG + Intronic
1098778350 12:74652574-74652596 CCAATTCATTCATTTACCTGTGG + Intergenic
1101851926 12:108410157-108410179 CCATTGAATGCATTTCTTTGGGG + Intergenic
1102521911 12:113483073-113483095 CCAATGACTGCATTCTCTTGGGG - Intergenic
1103579981 12:121907527-121907549 CAAATGCATACATTTTCAAGGGG + Intronic
1104539912 12:129654608-129654630 ACAAAGCATGAATTTTGTTGGGG - Intronic
1107451082 13:40510133-40510155 CCAATTTATGTATTTTTTTGTGG - Intergenic
1108147183 13:47490878-47490900 TCAATGCAAGCTTTTTCTTTTGG + Intergenic
1108448816 13:50538966-50538988 CCAACGGCTGTATTTTCTTGTGG + Intronic
1112444915 13:99455190-99455212 CCAATGCAAGTAGTTTCTTCTGG + Intergenic
1112492154 13:99876887-99876909 CCAATGTATGTCTTTTCTTGAGG + Intronic
1112752969 13:102600245-102600267 CCAATACATGCCTTTACATGTGG + Intronic
1118307700 14:64669099-64669121 GCAATGCCTGCATGTTTTTGTGG + Intergenic
1122345408 14:101055561-101055583 CCATGGCAAGCATTTTCCTGAGG + Intergenic
1122643057 14:103172701-103172723 CCAATGGATGCCTTTTGTTTTGG - Intergenic
1122908769 14:104816088-104816110 CCACTGCTTGCGTTTCCTTGGGG - Intergenic
1128377053 15:67084443-67084465 TCAATGCATATATTTTCCTGGGG + Intronic
1132789297 16:1676429-1676451 ACAATGGATACATTTTCTTCTGG + Exonic
1135936846 16:26787819-26787841 CAAATGCAAGCAGTTTCATGGGG - Intergenic
1138192757 16:55029895-55029917 CCCATGCATGCATATTTTAGGGG + Intergenic
1140459661 16:75129547-75129569 CCAATGGTTGCATTCTTTTGAGG - Intergenic
1143386287 17:6532790-6532812 CAAATGCTTTCTTTTTCTTGGGG + Intronic
1143947784 17:10609374-10609396 CCAATGCCTGCATTTTCCAGGGG - Intergenic
1147815460 17:43206674-43206696 CCAATACATGGATTCTCTTAGGG - Intronic
1148722701 17:49765065-49765087 CAACTGCATGCATTCTCTTTGGG - Intronic
1149726601 17:58901120-58901142 TGAATGCATGTATTTTCCTGCGG + Intronic
1151183368 17:72345745-72345767 GCAATGCATGCTTTCTCTTTTGG + Intergenic
1151588454 17:75026481-75026503 CCAATGGATGCCTTTTGTTTAGG - Intergenic
1155740083 18:29278734-29278756 ACAGTGCTTGCATTTTCTTCTGG + Intergenic
1157037958 18:43999521-43999543 AAAATGCATTCATTTTATTGGGG - Intergenic
1157375119 18:47156501-47156523 CCAGTGCACTCATGTTCTTGGGG - Intronic
1159791716 18:72789702-72789724 CCAAGGTCTGTATTTTCTTGAGG + Intronic
1159991316 18:74912050-74912072 CCGATGCATGGATCTTCCTGGGG + Intronic
1163794976 19:19332603-19332625 CAAATACAAGCATTCTCTTGTGG - Intronic
1164389989 19:27810676-27810698 CAAATGTATGAATTTTCTTCTGG + Intergenic
1164613531 19:29650149-29650171 CCAATGCAGGCGATTACTTGAGG + Intergenic
1168623528 19:57898121-57898143 CCAATGGATGCCTTTTGTTTGGG - Intronic
1168626729 19:57924369-57924391 CCAATGCAGGAATTGCCTTGAGG + Intronic
926015564 2:9448376-9448398 CCAATCCATGTTTTTTCTTCAGG + Intronic
928569431 2:32588530-32588552 CCATTTCCTGCATTTTATTGTGG + Intronic
930840675 2:55841735-55841757 CCAGTGCAGGCAATTTATTGGGG + Intergenic
932555833 2:72824604-72824626 TCACTGCTTGCGTTTTCTTGGGG - Intronic
933788880 2:85867739-85867761 CAAATTCTTGCATTTTCCTGAGG - Intronic
935461217 2:103337148-103337170 TAAATGCATGCATTTTTTTCTGG - Intergenic
935877420 2:107525749-107525771 CCAAAGCTTGCTATTTCTTGGGG - Intergenic
936896146 2:117429937-117429959 CCAATGCATGAAGTTCTTTGAGG - Intergenic
938180465 2:129177733-129177755 ATATTGCATGCATTTTCTTCTGG + Intergenic
940151311 2:150605109-150605131 CTAATGCATGCATTTTCTTTAGG - Intergenic
940756797 2:157692564-157692586 TCAATGAATACATTTTCTTGAGG + Intergenic
941870082 2:170374949-170374971 CCAATGCATGTATTTGATTCAGG + Intronic
941974888 2:171392795-171392817 GCAAAGCATGCATTTTGTTCAGG - Intronic
942127406 2:172841058-172841080 CCATAGCATGCATTTTTCTGGGG - Intronic
943068999 2:183119354-183119376 CCACTAGATGGATTTTCTTGAGG - Intronic
943583795 2:189714644-189714666 CCAATTCCTGCTTTGTCTTGTGG - Intronic
945633095 2:212308724-212308746 CCCAGGCATGTATTTCCTTGAGG + Intronic
946310388 2:218879908-218879930 CCTACGCAAGCATTTTCTGGGGG + Intergenic
946387187 2:219390938-219390960 GTAATGCAAGCATTTTCTGGAGG + Intronic
946972822 2:225114534-225114556 TCAGTGCATGCATTGTTTTGTGG - Intergenic
947879205 2:233490470-233490492 CCAACATATGCTTTTTCTTGAGG + Intronic
1170425561 20:16231875-16231897 ACCTTGCATGCATTTACTTGGGG - Intergenic
1171483731 20:25471949-25471971 CCAATACCTGCAGTTTCTAGAGG - Intronic
1172562427 20:35901123-35901145 CCTAAGCATGCTTTTTATTGAGG - Intronic
1173100135 20:40079869-40079891 CAAATGCATACATTCTCATGGGG - Intergenic
1173131200 20:40395384-40395406 CCAGTAGAGGCATTTTCTTGAGG - Intergenic
1174551875 20:51368032-51368054 TCAATGTATTCATTTTCTGGGGG + Intergenic
1177480813 21:21685060-21685082 CAAATAAATGCATCTTCTTGAGG - Intergenic
1179221452 21:39411345-39411367 AAAATGGATGCATTTTATTGAGG + Intronic
1181040398 22:20189630-20189652 CCAATACATGCCTTTTCTGTGGG - Intergenic
953231087 3:41065618-41065640 CAAGTGCATGCAGTTTATTGAGG - Intergenic
953651457 3:44808967-44808989 CCAGTGCGTGCATTCTCTGGGGG + Intronic
955813041 3:62811419-62811441 CCAATGCATGCATTTTCTTGAGG - Intronic
955995929 3:64680828-64680850 CAAATGCATGTATTTTTTTTTGG - Intronic
956526202 3:70165079-70165101 CCAGAGAATTCATTTTCTTGGGG - Intergenic
956917847 3:73891987-73892009 TGAATGCATGCATTTTCCTAGGG + Intergenic
957975200 3:87434163-87434185 CCAAAGTATGCATTTTCATGGGG - Intergenic
961050969 3:123746826-123746848 CCAATGACTTCATTTTCTAGGGG - Intronic
961129146 3:124449192-124449214 CCACTGTATGTATTCTCTTGTGG - Intronic
963334767 3:143962145-143962167 TGAATGCATGCATTTTCTTGTGG + Intergenic
964289919 3:155166654-155166676 CCAATGCAGGCATTTTATTATGG - Intronic
965934262 3:174087411-174087433 CCAATGCATGCGTATTCTGCTGG + Intronic
966339142 3:178905816-178905838 CAAAAGCATGCATTTTCCAGGGG - Intergenic
967257825 3:187611523-187611545 TCCATGCAAGCATTGTCTTGGGG + Intergenic
969602568 4:8185496-8185518 CCAATGCATTCATCCTCCTGCGG + Intronic
969921971 4:10548830-10548852 TCAATGCATGCATTTATTTCTGG + Intronic
970066706 4:12103269-12103291 CCTATGCATGCACAATCTTGTGG - Intergenic
971102941 4:23488264-23488286 CCAATGCATGGATTTATTTCTGG + Intergenic
971131415 4:23814933-23814955 CCAAAGCTTGCATTTTCAAGGGG + Intronic
980345251 4:131607790-131607812 CCAATGAATTCTTTTTCTTTTGG + Intergenic
983305831 4:165985365-165985387 TAAATGTATTCATTTTCTTGAGG + Intronic
986909833 5:12542366-12542388 ACAATGCATGCAAATTTTTGAGG - Intergenic
989114707 5:37941267-37941289 TCTCTGCATTCATTTTCTTGAGG + Intergenic
989160445 5:38385992-38386014 CCACTGCTTACATTTGCTTGTGG - Intronic
992090979 5:73316777-73316799 CCAAGGCATGATTTTTCTGGTGG - Intergenic
993635109 5:90333577-90333599 CATATGCCTACATTTTCTTGGGG + Intergenic
993823294 5:92647726-92647748 CCAATGCATGGACTTTCTTGAGG - Intergenic
994490470 5:100436672-100436694 ACAGTGCATGCTTATTCTTGAGG + Intergenic
995151625 5:108854544-108854566 GCAATGCATGTATTGTTTTGGGG + Intronic
996980813 5:129491870-129491892 ACAATATTTGCATTTTCTTGTGG + Intronic
998910448 5:146954336-146954358 TCAATTCATACATTTTCTGGAGG - Intronic
1000801453 5:165731860-165731882 CCCATGCATGCATTATCCAGTGG + Intergenic
1003517860 6:6832732-6832754 GCAATGCCTGCACTGTCTTGGGG + Intergenic
1004881741 6:20015383-20015405 CCACTTAATGCATTTTCTTTAGG - Intergenic
1007177549 6:39907062-39907084 CCAATCCAAGCATTTTCTCCTGG - Exonic
1007276087 6:40675057-40675079 CAAATGCAATCATTTGCTTGAGG + Intergenic
1008176642 6:48276119-48276141 CTGAAGCATGCATTTACTTGTGG - Intergenic
1011323524 6:86123305-86123327 TCAATGCATATATTTTCTTCAGG + Intergenic
1013300139 6:108797395-108797417 CCACTGCATTCATTCTCTTTGGG + Intergenic
1014583816 6:123172252-123172274 TCAATACCTGGATTTTCTTGAGG - Intergenic
1015297138 6:131608793-131608815 CCACAGCATGAATTATCTTGGGG - Intronic
1015332900 6:132002266-132002288 CAAATGTCTGCATTTTCATGTGG - Intergenic
1015914683 6:138203939-138203961 CCAATGCATTTATTTTCTAAGGG + Intronic
1016996200 6:149963908-149963930 CCTAGGCATGCACTTTTTTGGGG - Intergenic
1018940420 6:168305959-168305981 GAAATGCTTGCATTTTCTCGTGG + Intronic
1021808918 7:24383864-24383886 TCAACACATGAATTTTCTTGGGG - Intergenic
1021880957 7:25094891-25094913 ACAATGCATGGATTTTATTTGGG - Intergenic
1024994842 7:55265658-55265680 TGAATGCATGGATTTTCTTCTGG - Intergenic
1027741165 7:82007579-82007601 ACACTGCATGTATTTTCTTATGG + Intronic
1031784874 7:126016851-126016873 CCAAAGAATGCATTTTATTGAGG - Intergenic
1035301201 7:157898417-157898439 GCCATGAATGCTTTTTCTTGTGG + Intronic
1038162558 8:25053962-25053984 CTAATGCATGCATTCCCCTGAGG + Intergenic
1038210065 8:25509314-25509336 CTAATTCATTCATTTTTTTGGGG - Intergenic
1041326967 8:56678197-56678219 TCAATAAATGCATGTTCTTGAGG + Intergenic
1042729725 8:71919153-71919175 CACATGCATGCATTTCTTTGAGG + Intronic
1044294158 8:90507952-90507974 ACAACACATGCATTTTCCTGGGG - Intergenic
1044627168 8:94245355-94245377 CCAATGTATTTAGTTTCTTGGGG + Intergenic
1044982197 8:97727924-97727946 TTTATGCATGCATTTTATTGGGG + Exonic
1045897683 8:107238466-107238488 CCAACACATTCATTGTCTTGGGG - Intergenic
1046247027 8:111577489-111577511 CAAATGCAAGCATATTGTTGGGG - Intergenic
1046567832 8:115923226-115923248 ACAATGCATGCCTTTTCTTTTGG - Intergenic
1047344751 8:124016203-124016225 CCCATTCCTGCCTTTTCTTGTGG - Intronic
1047363762 8:124193433-124193455 TCTGTGCATCCATTTTCTTGTGG + Intergenic
1049384721 8:142337340-142337362 CAAATGTTTGCATTTTGTTGTGG - Intronic
1049825936 8:144667786-144667808 CCACTGCATGCATTGTTCTGAGG + Intergenic
1050787596 9:9425178-9425200 CCAGTACATCCATTTTATTGTGG + Intronic
1052380480 9:27765755-27765777 TCATTGTATTCATTTTCTTGGGG - Intergenic
1056408047 9:86295353-86295375 GCAAAGCATGTAATTTCTTGGGG - Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058582324 9:106471916-106471938 CCATTACATGCAATTTCTTTTGG + Intergenic
1061089595 9:128419519-128419541 CCAGTGCATTCATTCTCTCGAGG + Intronic
1186130563 X:6461236-6461258 CCAGTGGATGCATTTTGTGGGGG - Intergenic
1186498782 X:10033907-10033929 CCAAAGTCTGCATTTTCTTAAGG + Intronic
1188565659 X:31523414-31523436 CCAATGTATTCTTCTTCTTGGGG - Intronic
1190496030 X:51029309-51029331 CCAGTCCATGCATTTACCTGAGG + Intergenic
1191055629 X:56237139-56237161 TCAATGTATGAATTTTTTTGGGG - Intronic
1192686121 X:73306743-73306765 CCTTTGCATGGAGTTTCTTGTGG - Intergenic
1194357951 X:92911212-92911234 GCAATGAATGCATTTCCTTTGGG - Intergenic
1194773601 X:97935171-97935193 CCAAAGAAAGCATTCTCTTGGGG + Intergenic
1195272707 X:103248628-103248650 CCTTTGGTTGCATTTTCTTGAGG - Intergenic
1199411824 X:147533047-147533069 CCAAGGCATGCAATGTCTTCAGG - Intergenic
1200666129 Y:6026821-6026843 GCAATGAATGCATTTCCTTTGGG - Intergenic
1200883908 Y:8250627-8250649 CAAAGGCATGAATTTTCTTCTGG + Intergenic
1201402452 Y:13617913-13617935 CCGATGGATGCCTTTTGTTGGGG + Intergenic