ID: 955814903

View in Genome Browser
Species Human (GRCh38)
Location 3:62831976-62831998
Sequence CATCTTGACCAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955814903 Original CRISPR CATCTTGACCAGAGGGAAGC TGG (reversed) Intronic
900363632 1:2301617-2301639 CATCTTCCCCCTAGGGAAGCAGG + Intronic
902169235 1:14597723-14597745 CCTGTTGACCAGAGGGTTGCTGG + Intergenic
902689938 1:18104805-18104827 CACCATGAACAGAGGGAGGCTGG + Intergenic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904378600 1:30096621-30096643 CATCATGGTCAGAGGGAAGCAGG + Intergenic
906934095 1:50196530-50196552 CATTTTCATCAAAGGGAAGCTGG - Intronic
907605124 1:55808322-55808344 CATCTTCACTAGAGGGAGACAGG + Intergenic
909605936 1:77508384-77508406 CATGGTTACCAGAGTGAAGCTGG - Intronic
910283689 1:85529887-85529909 CACCTTGCCCAGTGTGAAGCAGG + Intronic
912152993 1:106882289-106882311 CACCTTCTCCACAGGGAAGCAGG + Intergenic
912583230 1:110738370-110738392 CATCCTGCCCAGAGGGCACCTGG + Intergenic
913238485 1:116806272-116806294 AATCTTGACCATTGGGCAGCAGG - Intergenic
914206326 1:145533103-145533125 CACCTTGCCCAGTGTGAAGCAGG - Intergenic
915913715 1:159929254-159929276 CATCTTTACCAGGGGGATGTTGG - Intronic
915953646 1:160205975-160205997 AAGCTTGTCCAGAGGGAAGGAGG + Intronic
917928075 1:179805624-179805646 CAGCTTGAGCAGAGAGAAACTGG - Intronic
918658267 1:187056079-187056101 AATCTTGACCAGAGAGAAGCTGG - Intergenic
920295254 1:204952151-204952173 CATCAGGCCCAGAGGCAAGCGGG - Intronic
1062973302 10:1665021-1665043 CACCTTGACCAGGGGCAAGGGGG + Intronic
1063203216 10:3806009-3806031 CATCTTGTCCTGAAGGCAGCAGG - Intergenic
1068630374 10:59291443-59291465 GCTCCTGAACAGAGGGAAGCTGG - Intronic
1069068911 10:63974354-63974376 CCTCTTGAGCAGGGGGGAGCAGG - Intergenic
1071996306 10:91153094-91153116 CATCTTAACCAGATGGAAAAGGG - Intergenic
1072888608 10:99301674-99301696 CAGCTAGACCAGATGGCAGCAGG + Intergenic
1074302719 10:112247624-112247646 TCTCTTGACCAGGGAGAAGCAGG + Intergenic
1077054884 11:586664-586686 CACCTTGACCAGCAGGGAGCAGG - Intronic
1077362235 11:2145851-2145873 GGTCTTGACTAGAGGGGAGCCGG - Intronic
1077405745 11:2381798-2381820 CTTCTTGCCCAGAGGGGTGCTGG - Intronic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1080213464 11:29814838-29814860 CATCTTCACCAGAGGAAGACAGG - Intergenic
1081690310 11:45073622-45073644 TAGCTGGACCAGAAGGAAGCTGG + Intergenic
1083376532 11:62227619-62227641 CATCTTGAAAAGAGGTAAACAGG + Intergenic
1084163481 11:67364076-67364098 CAGCTCCACCAGAGGCAAGCAGG + Intronic
1085191209 11:74624894-74624916 TAACTTGCCCAGAGTGAAGCGGG + Intronic
1088546048 11:110959978-110960000 CTTCTGGAACAGATGGAAGCTGG - Intergenic
1089514702 11:119025120-119025142 CATATAGACCAGTGAGAAGCTGG - Intronic
1090088253 11:123670403-123670425 CTTCTGGACCAGAGGGAAAAGGG + Intergenic
1090206039 11:124884988-124885010 CATCTTGACCAGAGGGCCTCTGG - Intronic
1090919368 11:131194535-131194557 CATTTTAACAAGAGAGAAGCGGG - Intergenic
1093027224 12:14255953-14255975 AAGCTTGACCAGAGGGTAGGAGG + Intergenic
1097141746 12:56908334-56908356 CATCCTGGCCCGAGGGCAGCGGG - Intergenic
1098221607 12:68275646-68275668 CATCGTGACCAGAGGCTTGCAGG - Intronic
1098772125 12:74565775-74565797 CATCCTGAACACAGGAAAGCAGG - Intergenic
1101848712 12:108385310-108385332 CACCCTGACCAGAGGAATGCAGG - Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1104929415 12:132329895-132329917 AAGCTTGACCCGAGGGCAGCGGG + Intergenic
1105797204 13:23866995-23867017 CATCTTGACCAGGTGGTAGCAGG - Intronic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1110332522 13:74288876-74288898 CTTGTTGACCAGTGGGGAGCAGG - Intergenic
1115296402 14:31832171-31832193 CATCTTGACTACATGGAAGAAGG - Intronic
1118327826 14:64793352-64793374 CATCTTCACCAGAGAGCAGCCGG + Exonic
1120191761 14:81446284-81446306 CCTCTGGACCTGAGGGCAGCTGG + Intergenic
1120255058 14:82107799-82107821 TATCTTAACAAGAGAGAAGCTGG - Intergenic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1121458407 14:94054396-94054418 CATCTTTGCCAGCAGGAAGCTGG + Intronic
1124031422 15:26015856-26015878 CACCTCCACCAGCGGGAAGCTGG - Intergenic
1127284522 15:57520837-57520859 CAGCTTAACCAGAAGGAAGTTGG - Intronic
1127460647 15:59195404-59195426 CATCTTGAGCAGAGGGAAAAAGG + Intronic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1130021478 15:80235200-80235222 CATCTTGAACAGAGGAACACAGG - Intergenic
1130653730 15:85777330-85777352 GATCTTGACCTCAGGAAAGCAGG - Intronic
1132307753 15:100829594-100829616 CATCTGGACCAGTGGCAGGCTGG - Intergenic
1132743913 16:1428889-1428911 CAGCTGGATCAGAGGGGAGCTGG + Intergenic
1132758006 16:1495348-1495370 CATCTTCATCAGCCGGAAGCTGG - Exonic
1134275929 16:12776111-12776133 GATCTTTACAAGAGGAAAGCAGG + Intronic
1135618484 16:23932696-23932718 CATGTGGACCAGAGGGATGGGGG + Intronic
1139149863 16:64369443-64369465 CAGATTGACCATGGGGAAGCTGG - Intergenic
1140821720 16:78669129-78669151 CATCTCCACCACAAGGAAGCTGG + Intronic
1141699766 16:85636953-85636975 CATCTGCGCCAGAGGGCAGCAGG + Intronic
1142677260 17:1521460-1521482 CATCATTACTAGAGGGAAGGAGG + Intronic
1143983418 17:10890607-10890629 CATCGTGACCAGAGTGCCGCTGG + Intergenic
1146916242 17:36680188-36680210 TATTTTCCCCAGAGGGAAGCGGG + Intergenic
1148056832 17:44803665-44803687 CTTCTTAACCAGACGGAAGCGGG + Exonic
1151209669 17:72535151-72535173 CATCTCAACCACAGGGCAGCTGG + Intergenic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1151901304 17:77017204-77017226 CATCTTAGCCACAGGGAAGTGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156265020 18:35480311-35480333 CATCTTGCCCATAGGGGAGAAGG + Intronic
1157294927 18:46435539-46435561 CATCTGGCCCAGAGGGTGGCTGG - Intronic
1157590434 18:48833421-48833443 CATCTTTCCCAGAGGGCTGCAGG - Intronic
1158215639 18:55097842-55097864 AATCCTAACCAGAGAGAAGCTGG - Intergenic
1159892040 18:73962114-73962136 CTTCTTGGCCACAGGCAAGCAGG + Intergenic
1161116406 19:2499302-2499324 CATCTGGAGCAGAGGGAGGGAGG - Intergenic
1164641144 19:29826741-29826763 AATCTTGAACAGGGGGAAGGTGG - Intergenic
1164906679 19:31973818-31973840 CATCTTGCCCAGAGGACAGTGGG + Intergenic
1165993397 19:39828289-39828311 CAGCTTGGCCAGAGGGTAGGGGG - Exonic
1167323910 19:48812588-48812610 CATCTGGATCAGAGGGAGGAGGG - Intergenic
1168182247 19:54669879-54669901 AATCTTGAGCAAAGGGAAGAAGG - Exonic
1168661761 19:58172877-58172899 TATCTTTACAAGAGGGAGGCAGG - Intergenic
930727190 2:54693779-54693801 AATCTCGACCAGCTGGAAGCAGG + Intergenic
934025163 2:87996421-87996443 CATCTCGGCTAGAAGGAAGCAGG - Intergenic
934935125 2:98459841-98459863 CAACTTGACCTCAGGGAAGCAGG - Intronic
935831342 2:107003950-107003972 CAACTTTTCCAGAGTGAAGCAGG + Intergenic
938694520 2:133823248-133823270 CATCAAGACCAAAGGCAAGCAGG + Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
944218339 2:197277681-197277703 AGCCTTGACCAGAGGGAAACAGG + Intronic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
1168771391 20:419197-419219 CCACTTGGCCAGATGGAAGCTGG + Intronic
1168820641 20:771222-771244 CATGTTGACCAGTTGGAGGCTGG - Intergenic
1168926868 20:1588715-1588737 CCTCTTGAACTGAGGGAGGCAGG - Intronic
1169357872 20:4923235-4923257 CATCTTGAAGGGAGGGAGGCAGG + Intronic
1170032151 20:11955078-11955100 CATCTTTATAAGAGGGAAGTAGG + Intergenic
1172303203 20:33863987-33864009 CATCCTGACCAAAGCAAAGCCGG - Intergenic
1172719190 20:36986222-36986244 CATCTTGCCCAGGGTGAAGAGGG + Intergenic
1175953853 20:62597971-62597993 GATCTGGACCAGAGACAAGCTGG + Intergenic
1176067573 20:63206485-63206507 CACCTTGGGTAGAGGGAAGCTGG - Intronic
1177612165 21:23465926-23465948 CATAATGTCCAGAGGGATGCTGG + Intergenic
1177867596 21:26531223-26531245 CATGCTCACCACAGGGAAGCTGG + Intronic
1178020148 21:28398540-28398562 CATCTTTAGCAGATGGAAGAGGG - Intergenic
1181442725 22:22944998-22945020 GGTCATGACCAGAGGGAACCTGG - Intergenic
1183504178 22:38199956-38199978 CATCATGAGCAAAGGAAAGCAGG + Intronic
1184914244 22:47558356-47558378 CGTCTTTACCAGATGGAAGAGGG + Intergenic
952213642 3:31254125-31254147 CATCTTGACTGGAGGGAAAAGGG - Intergenic
953548217 3:43880271-43880293 CACCTGGAACAGCGGGAAGCAGG + Intergenic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
954485987 3:50851590-50851612 CATATTGATCTTAGGGAAGCAGG + Intronic
955197026 3:56813961-56813983 CATCTGTACCAGCTGGAAGCAGG + Intronic
955814903 3:62831976-62831998 CATCTTGACCAGAGGGAAGCTGG - Intronic
956593957 3:70946358-70946380 CAGCTTGATCAGAGGGAACTTGG - Intergenic
956933024 3:74067605-74067627 CATTTTGCCCAGATTGAAGCTGG + Intergenic
960300936 3:116001782-116001804 GATCTTTATCAGAGAGAAGCAGG - Intronic
960673814 3:120176111-120176133 CATCATGACCAGAGGCAGGGAGG - Intronic
962710317 3:138080738-138080760 CATCTTGACTGGAGAGAGGCAGG + Intronic
963723909 3:148897525-148897547 CATGTTGACCAAAGGCAATCAGG + Intergenic
965061234 3:163787933-163787955 CATCTGGACTAGGGGAAAGCAGG + Intergenic
970429073 4:15972082-15972104 CTTATTGAGCAGAGGGATGCTGG + Intronic
971102743 4:23485895-23485917 CCACTTGGCCAGAAGGAAGCAGG - Intergenic
971622848 4:28878240-28878262 CATCTGGAACAGATGGAAGAAGG + Intergenic
971936377 4:33153620-33153642 CATCTTGACTAGAGGAATACAGG + Intergenic
973941402 4:55914687-55914709 AATCTTGAGCAGAGTGATGCTGG + Intergenic
975509571 4:75178821-75178843 CATTTTGAAGATAGGGAAGCAGG + Intergenic
976051432 4:81015678-81015700 CATCTTACACAGATGGAAGCAGG + Intergenic
978392403 4:108240946-108240968 TATCTTGACCTGAGGCAAGGTGG + Intergenic
982084106 4:151817057-151817079 AATCTTGCCCAGAGTGAAGGAGG + Intergenic
983327614 4:166278455-166278477 CATCTTAACCAACGGGAGGCTGG - Intergenic
988453553 5:31366955-31366977 CATCTTGACCATGTGTAAGCGGG - Intergenic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
990083280 5:51943887-51943909 CATCTTCTTCAGAGGGATGCAGG - Intergenic
990486078 5:56260463-56260485 AATCTTGACCATTGGGAAACAGG - Intergenic
990605745 5:57408127-57408149 AATCTTGACCAGGGAGAAGCTGG + Intergenic
992852093 5:80821008-80821030 CATCTTGCAGAGAGAGAAGCAGG - Intronic
994283094 5:97929815-97929837 CAACTTGACCTGGGGGAAGCTGG + Intergenic
994521596 5:100844698-100844720 CACATTCACCAGAGGCAAGCTGG - Intronic
996319147 5:122194256-122194278 GATGTTGACCGGAGGGATGCTGG + Intergenic
997978906 5:138457061-138457083 CAACTGGACCAGAGGGAAACTGG + Intergenic
999397412 5:151238717-151238739 CATCTGGACCAGAAGGCAGGGGG + Intronic
1000195616 5:158954705-158954727 CATCTTGGGCAGAGTGAGGCTGG - Intronic
1000486441 5:161849985-161850007 CATCTCAAACAGATGGAAGCTGG - Intronic
1002199462 5:177519473-177519495 CATCTTGCAAAGAGGGAAACAGG + Intergenic
1003352717 6:5333616-5333638 CACCTTGAGCAGAGGCAGGCAGG + Intronic
1007313054 6:40961950-40961972 CATCCAGAGCGGAGGGAAGCTGG - Intergenic
1008334086 6:50279310-50279332 TGTTTTGACCAGAGGTAAGCAGG - Intergenic
1008564234 6:52751574-52751596 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008568548 6:52792853-52792875 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008569921 6:52806619-52806641 CACCTTCAGCAGAGGGAAGTTGG + Intergenic
1008573003 6:52832856-52832878 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008577382 6:52874066-52874088 CACCTTCAGCAGAGGGAAGCTGG + Intronic
1008579961 6:52897822-52897844 CACCTTCAGCAGAGGGAAGTTGG + Exonic
1017483351 6:154880044-154880066 CATGCTGACCAGGAGGAAGCCGG - Intronic
1018458577 6:163975493-163975515 CATCTGTGCCAGTGGGAAGCTGG + Intergenic
1019838310 7:3413268-3413290 TATCATGAGCAGAGGGGAGCAGG + Intronic
1020081862 7:5290590-5290612 TATCTGGAACAGAGGGGAGCAGG + Intronic
1022509806 7:30927844-30927866 CACCTGGCCCAGAAGGAAGCAGG + Intergenic
1025197051 7:56941547-56941569 TATCTGGAACAGAGGGGAGCAGG - Intergenic
1025674897 7:63635390-63635412 TATCTGGAACAGAGGGGAGCAGG + Intergenic
1027808492 7:82861014-82861036 CATCTTCACTAGAGGAAAACAGG + Intronic
1028825305 7:95265636-95265658 CATTTACACCAGAAGGAAGCTGG - Intronic
1030223808 7:107126547-107126569 AAAGTTGACCAGAGCGAAGCAGG + Intronic
1030565892 7:111155126-111155148 CATCTTGATCCTAGGGAAGAAGG - Intronic
1032865182 7:135917698-135917720 CATCCTCAGGAGAGGGAAGCAGG + Intergenic
1034102181 7:148459315-148459337 CATCCTGACCAGAGGAGGGCAGG + Intergenic
1038932779 8:32213791-32213813 CAGCTTAACAAGAGAGAAGCAGG + Intronic
1042736585 8:71996228-71996250 CAGCTTGACTAGAAGGAAGATGG - Intronic
1047613347 8:126542370-126542392 CCTCTTTACCAGAGGGAGGCAGG - Intergenic
1055399545 9:75908482-75908504 CTTTTTGACCAGAGGAAAGGGGG - Intronic
1058324786 9:103681668-103681690 CATCTTTACCAGGGCGGAGCAGG - Intergenic
1058892856 9:109375553-109375575 GCTCCTGACCAGAGGGAAGGTGG + Intronic
1059380135 9:113916986-113917008 CATCTTGTTCAGAAGGAAGAGGG + Intronic
1061071173 9:128311578-128311600 CCACGTGACCAGAGAGAAGCTGG - Exonic
1062457378 9:136646065-136646087 CATATCCACCAGAGGGCAGCTGG + Intergenic
1062525185 9:136975381-136975403 CATCTTGACCACAGGGACTGAGG + Intergenic
1186929975 X:14378450-14378472 CTACTTGACCAGTGGGAAACTGG + Intergenic
1192208916 X:69114813-69114835 ATTCTTGACCAGCTGGAAGCAGG + Intergenic
1192499045 X:71636619-71636641 CTTCTTGACATCAGGGAAGCAGG + Intergenic
1192546402 X:72018352-72018374 CACCTTAACAAGAGGGAAACTGG - Intergenic
1194467652 X:94253943-94253965 CATCTTTATAAGAAGGAAGCAGG - Intergenic
1194923624 X:99796795-99796817 CATCATGATCTCAGGGAAGCAGG + Intergenic
1195758918 X:108225460-108225482 AATCCTGAGCAGATGGAAGCAGG - Intronic
1197100071 X:122642375-122642397 CATCTTTATCACAGGGAATCAGG - Intergenic