ID: 955817424

View in Genome Browser
Species Human (GRCh38)
Location 3:62860388-62860410
Sequence CTGCAGATACTGAGGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 2, 2: 3, 3: 28, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955817424_955817430 7 Left 955817424 3:62860388-62860410 CCATCATCCCTCAGTATCTGCAG 0: 1
1: 2
2: 3
3: 28
4: 263
Right 955817430 3:62860418-62860440 GTTCTAGGACCATCCCGTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 50
955817424_955817429 -8 Left 955817424 3:62860388-62860410 CCATCATCCCTCAGTATCTGCAG 0: 1
1: 2
2: 3
3: 28
4: 263
Right 955817429 3:62860403-62860425 ATCTGCAGGAGATTGGTTCTAGG 0: 1
1: 8
2: 51
3: 215
4: 622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955817424 Original CRISPR CTGCAGATACTGAGGGATGA TGG (reversed) Intronic
900439543 1:2646816-2646838 CAGCAGATCCTGAGGGAAGGTGG - Intronic
900993468 1:6108307-6108329 ATGGAGAGACGGAGGGATGAAGG + Intronic
900998199 1:6134153-6134175 CTGAAGAAACTGCGGGATGAGGG - Exonic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901511631 1:9720728-9720750 CTGCAGCTGCTGAGGGGTGTGGG - Exonic
902327998 1:15715200-15715222 CTGCATATACTAAGGGCCGATGG - Intronic
902483005 1:16721543-16721565 CTGCAGCTACTGAGAGGTGGAGG + Intergenic
902908104 1:19574214-19574236 CTGCAGACAGGGAGAGATGAAGG - Intergenic
903955450 1:27022241-27022263 ACGCAGAGACTGAAGGATGAGGG - Intergenic
904344604 1:29859711-29859733 CAGGAGATGCTGAGGGATGGAGG + Intergenic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
905770007 1:40631322-40631344 CCATGGATACTGAGGGATGACGG - Intronic
905913371 1:41669012-41669034 CTGGAGTTCCTGAGGGATCATGG - Intronic
907221427 1:52909826-52909848 CTGCAGATGCAGAGGGCTGACGG + Intronic
908050727 1:60227043-60227065 CAGCAGCTACTGAGGAAAGAAGG + Intergenic
908396316 1:63728729-63728751 CGGCAGAGAGTGAGGCATGAAGG + Intergenic
908422707 1:63974848-63974870 CTACATTTACTGAGGTATGAGGG + Intronic
908727124 1:67188412-67188434 TGGCAGATACTGTTGGATGACGG - Intronic
909780921 1:79545969-79545991 GTGCAGAAACTGAGGGAAGGAGG - Intergenic
911476272 1:98377284-98377306 CTGCAGATACTGAGGGACAATGG - Intergenic
912567767 1:110600812-110600834 CTGCAGATACCTGGGGATGTGGG + Intronic
914459362 1:147868866-147868888 CTGCAGGAACTGTGGGCTGATGG - Intergenic
914505652 1:148286902-148286924 CTGCAGATACAGTGGGAAAATGG + Intergenic
914506904 1:148297249-148297271 CTGCAGATACAGTAGGAAGATGG - Intergenic
915298508 1:154938699-154938721 AAGCGGATGCTGAGGGATGAGGG - Intergenic
915399434 1:155611613-155611635 CTCCAGATACTGATGGATGGGGG + Intronic
915416547 1:155747193-155747215 CTCCAGATACTGATGGATGGGGG + Intergenic
916077109 1:161207784-161207806 CTTCAGATACTGAAGGAGAAAGG - Intronic
918663792 1:187122334-187122356 ATGCACATACTCAGGGATCATGG + Intergenic
919649114 1:200128084-200128106 CTGCATATACTGAGGGATGACGG - Intronic
919786465 1:201261463-201261485 CTGGAGCTACTGGGGGAAGAGGG - Intergenic
919931381 1:202223484-202223506 ATGCAGACACTGAGGTTTGAGGG + Intronic
920228272 1:204453663-204453685 CTACAGGAACTGAGGGAAGAAGG + Intronic
921255044 1:213331496-213331518 GTGCAGAGACACAGGGATGAAGG + Intergenic
923935165 1:238751785-238751807 ATGCAGTCACTGAGGGAAGAGGG - Intergenic
924662541 1:246034954-246034976 CTGCATATATTGGGGGAGGAAGG - Intronic
1063255577 10:4323689-4323711 TTGAAGATACTGAGGGAGAAGGG + Intergenic
1067299771 10:44997757-44997779 ATGCATATAGTGAGGTATGAAGG + Exonic
1067541788 10:47160237-47160259 CTTAAGAAACTGTGGGATGAAGG - Intergenic
1068591822 10:58860842-58860864 CAGCAGACACTGAGGGCTGAAGG - Intergenic
1069002807 10:63284492-63284514 CTGCAGATGCTGCTGGTTGAGGG - Intronic
1070430244 10:76330604-76330626 GGGCAGAGACAGAGGGATGAGGG + Intronic
1071458336 10:85868414-85868436 CTGCACATACTTAGGGTTGAAGG + Intronic
1072222173 10:93335723-93335745 CTGCAGCCTCTGAGGGATGCTGG - Intronic
1072222189 10:93335802-93335824 CTGCAGCCTCTGAGGGATGCTGG - Intronic
1073063813 10:100746876-100746898 CTGGAGATGCTGAGAGATGAGGG - Intronic
1073671984 10:105601579-105601601 TTGCAAATACTAAGGGAAGATGG - Intergenic
1075310407 10:121409101-121409123 TGGCACAAACTGAGGGATGAAGG - Intergenic
1076153069 10:128179211-128179233 CTGCAGATGATGATGTATGACGG - Intergenic
1076343426 10:129765206-129765228 CAGGAGCTACTTAGGGATGAAGG + Intronic
1077303237 11:1856652-1856674 CTCCAGATTCTGAAGGAGGAAGG + Intronic
1078030182 11:7742324-7742346 CTGGAAATACTGAGGAATGAAGG + Intergenic
1079395504 11:20059385-20059407 CTGCAGATTCTCTGTGATGAGGG + Intronic
1080681979 11:34485951-34485973 CTGCAGCTGGTGGGGGATGAGGG + Intronic
1080913850 11:36634616-36634638 TTTCAGATAGTGATGGATGAAGG + Intronic
1081594799 11:44451847-44451869 CTGCAGAGGCTGCAGGATGAAGG - Intergenic
1081868050 11:46370443-46370465 CTGCACTTACTGAGGGAGGCGGG - Intronic
1083006985 11:59355968-59355990 TGGCAGAACCTGAGGGATGAAGG + Intergenic
1084424127 11:69075260-69075282 CTGCAGATACCGAGGGGCAACGG - Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085237219 11:75024336-75024358 CTGCAGAAACTGAGGGAAAGTGG + Intergenic
1085528948 11:77180360-77180382 CCACAGATACTGAGGGAAGGGGG - Exonic
1086806835 11:91254350-91254372 CTGGAGATAGAGAGTGATGATGG - Intergenic
1087211386 11:95448968-95448990 CCACAGATACGGAGGGCTGATGG - Intergenic
1088763459 11:112953786-112953808 ATGTAAATACTGAGGGATGAGGG - Intergenic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089457236 11:118632739-118632761 CTGCAGATCCTGAAGGCTCAAGG - Intronic
1090875374 11:130784307-130784329 CTGCACATACTGAAGAATGTAGG + Intergenic
1091059787 11:132450501-132450523 CTGCAGAAAATGAGTCATGATGG + Intronic
1091284097 11:134398564-134398586 ATGAAGAAACTGAGGCATGAGGG + Intronic
1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG + Intronic
1092668645 12:10836619-10836641 CAGCAGAAACTGAGAGATAAGGG + Intronic
1093914596 12:24787571-24787593 CTGCAGATGCTAAGGGAGTAGGG + Intergenic
1096683122 12:53270062-53270084 CTGCAGCAGCTGCGGGATGATGG + Exonic
1097167481 12:57093496-57093518 CAGCAGACACTGATGGACGAGGG + Exonic
1098947919 12:76608874-76608896 GTGCAGAGACTGAAGAATGAAGG + Intergenic
1099464829 12:82970827-82970849 CTGCAGTTACTGAGAGAAAAAGG - Intronic
1099556801 12:84119084-84119106 CTCCAGATACTGAGGTTTTAGGG - Intergenic
1101032496 12:100674388-100674410 CTGCTGATGATGATGGATGATGG - Intergenic
1105717491 13:23081861-23081883 CTCCAGCTAGTGTGGGATGAGGG - Intergenic
1106565781 13:30883511-30883533 CTGCACCCACTGAGGGGTGAGGG - Intergenic
1109367514 13:61375360-61375382 TTTAACATACTGAGGGATGAAGG - Intergenic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1112717660 13:102205128-102205150 CAGCAGAAACTGAGAGAAGAAGG + Intronic
1113074837 13:106458001-106458023 CTATAGATTCTGAGTGATGATGG + Intergenic
1113470013 13:110537727-110537749 CTGCACATAGTGAGGGCTCAAGG - Intronic
1116924888 14:50624514-50624536 CTGCAGAGAGGGAGGGATGGGGG - Intronic
1118448002 14:65869191-65869213 CTGCTGAGAGTGAGGGGTGATGG + Intergenic
1118857134 14:69632367-69632389 CTGCATTTACTGAGGGAGGAGGG - Intronic
1121054156 14:90839275-90839297 CTGGAGAGACCTAGGGATGAAGG + Intergenic
1121679990 14:95785818-95785840 TTGTGGATACCGAGGGATGACGG + Intergenic
1122880170 14:104687269-104687291 CTGGAGGTACAGAGGGTTGAGGG + Intergenic
1126216126 15:46157114-46157136 CAGCTGCTACTAAGGGATGAGGG - Intergenic
1127209310 15:56756686-56756708 TTGCAGATATTGAGGGACAATGG - Intronic
1128192648 15:65717972-65717994 CAGCAGAGACCGAGAGATGATGG - Exonic
1128904340 15:71453692-71453714 ATCCAGACACTGAGGGATGTGGG + Intronic
1129606444 15:77027532-77027554 CTGCAGAGGCTCAGGGATGCAGG + Intronic
1130044740 15:80435104-80435126 CTGCAGACACTAAGGGATTGGGG - Intronic
1130116624 15:81010805-81010827 CTCCAGAAAGAGAGGGATGAGGG - Intronic
1130687390 15:86050677-86050699 CTGCAGATACCTAAGGATAAGGG + Intergenic
1130712554 15:86298072-86298094 CTTCAGATACTGTGGCAGGAAGG + Intronic
1132115404 15:99131992-99132014 CTGCAGATATGGACGGATCAGGG + Exonic
1136104068 16:28016369-28016391 AAGCAGATGCTGAGGGTTGAAGG + Intronic
1139357996 16:66378840-66378862 CAGCAGACAGTGAAGGATGAAGG + Intronic
1139678555 16:68541988-68542010 CTGCAGATAACCAGGGATGAAGG + Intronic
1140479228 16:75253519-75253541 ATGCAGCTACTGGGGGAGGAGGG - Intronic
1143081303 17:4383360-4383382 ATGCAGATACACAGGGATAAAGG + Intergenic
1143141581 17:4744459-4744481 CTGCAGAGGGTGAGGGCTGAGGG + Exonic
1143143270 17:4755315-4755337 CTACAGAGCCTGAGGGGTGAAGG - Intergenic
1143225072 17:5294604-5294626 CCTCAGATACTGAGGGAAAACGG + Intronic
1143766774 17:9143060-9143082 CTGGAGGTGATGAGGGATGAAGG + Intronic
1145062626 17:19742548-19742570 GTCCAGGTACTGGGGGATGATGG + Exonic
1145888064 17:28396447-28396469 CTCCAGATACTGAGGAAAGTGGG - Exonic
1146558674 17:33849400-33849422 CTGTGGAGACTGAGGAATGAGGG + Intronic
1148720020 17:49745121-49745143 CCACAGATACAGAGGGCTGATGG + Intronic
1149810617 17:59666867-59666889 CTGCAGATTCTGACGGATGTTGG - Exonic
1151021553 17:70623151-70623173 CTGAAGATAGAGAGGGTTGATGG - Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1152880398 17:82811525-82811547 CTGCAGCTACTTTGGGATGAAGG - Intronic
1153842534 18:9019857-9019879 CTTCAGAGACTGAGGTAGGAGGG + Intergenic
1154106519 18:11528131-11528153 CTGCAGACCCTGAGGGCTCAGGG - Intergenic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1155249342 18:23940205-23940227 CTGCAGATACTGTGAGGGGAGGG + Intronic
1157312894 18:46565551-46565573 CTGCAGATACTGAGGAATGACGG - Intronic
1157409940 18:47455127-47455149 CTGCCTACACTGAGGGCTGAAGG - Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157941290 18:51931620-51931642 GTGAAGACACTGAGGCATGATGG + Intergenic
1158547990 18:58411966-58411988 AGGCAGATAATGAGGGATGTGGG - Intergenic
1158679841 18:59557347-59557369 AAGCAGAAACTGAGTGATGAGGG - Intronic
1160007327 18:75076897-75076919 CTGCAGGCACTGTGGGATGCGGG + Intergenic
1160361984 18:78291099-78291121 CTGGAGATACATAGTGATGATGG - Intergenic
1160757479 19:765194-765216 GAGCAGAGACTGAGGGAGGAGGG + Intergenic
1162173635 19:8812711-8812733 AGGCAGATTCTGAGGGATCAGGG + Intronic
1163253352 19:16139905-16139927 CTGCGGACACTGAGGGGTGTGGG + Intronic
1163649684 19:18509968-18509990 CTGCAGGTACTGAGGCTTCAGGG - Intronic
1164703964 19:30305560-30305582 CTGCAGCTTCTCAGTGATGAAGG - Intronic
1167236585 19:48319351-48319373 CTGCAGGTACTGGGGCATCATGG - Intronic
1167429299 19:49445336-49445358 CAGCAGAAACTAAGAGATGAGGG + Intergenic
1168135650 19:54349481-54349503 ATGCAGATCCTGAGGGTGGACGG + Intergenic
1168236063 19:55063709-55063731 CTGCTGAGTCTGAGGGAGGAGGG + Intronic
925441906 2:3895319-3895341 CTGCAGCTGCTGTGGGAAGATGG + Intergenic
926103162 2:10133545-10133567 CTGCAGCCACTCACGGATGAGGG - Intergenic
927146363 2:20168961-20168983 CTGCCGGTCCTGTGGGATGAGGG - Intergenic
927358041 2:22196599-22196621 CTGCAGATTTGGAGGGATGGTGG - Intergenic
927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG + Intronic
930149659 2:48045530-48045552 ATGCAGTTACAGAGAGATGACGG + Intergenic
930155855 2:48107026-48107048 ATGCAGATGCCGAGGGGTGAGGG + Intergenic
930775546 2:55166750-55166772 CTGAAGATACAAAGGGATCAAGG + Intergenic
934560754 2:95312172-95312194 CTGCAGGACCTGAGGGATGGAGG - Intronic
938718545 2:134043608-134043630 CTGCTGATACTGAGGCAAAAAGG + Intergenic
940112274 2:150167954-150167976 CTGCAAACACTGAGTAATGAGGG + Intergenic
941246604 2:163105895-163105917 ATGCAGAACCTGAGGTATGAAGG - Intergenic
942218494 2:173746218-173746240 CTGCAGATAGTGTGGGGTGAAGG - Intergenic
943801970 2:192071553-192071575 TCGCAGACACTGAGAGATGACGG - Intronic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946299118 2:218811717-218811739 CTGCAGAGGCTGAGGAATAAAGG - Intronic
947212103 2:227717882-227717904 CTGCTAAGACCGAGGGATGACGG + Intronic
1168771177 20:417880-417902 CTGCAGCTCCTGAGGGTTGAGGG - Exonic
1169560925 20:6799924-6799946 CTGGATTTACTGAGGGATGTGGG + Intergenic
1170984998 20:21249573-21249595 CTGCAGAAACTCAGGTGTGAAGG - Intergenic
1171156449 20:22878910-22878932 ATGGGGATAATGAGGGATGAAGG - Intergenic
1173474180 20:43347190-43347212 CTGCAGAGACTGAGAGATTGTGG - Intergenic
1174125260 20:48299752-48299774 ATGCAGATACTGAAAGATGGTGG + Intergenic
1175068422 20:56310700-56310722 CTGCAGACACCCAGAGATGAAGG + Intergenic
1175363290 20:58432031-58432053 ATGAAGAAGCTGAGGGATGATGG + Intronic
1175604741 20:60303480-60303502 CTGCATATTTTAAGGGATGAAGG - Intergenic
1176222812 20:63978173-63978195 ATGCAGTTACTGTGGGAAGAGGG - Intronic
1177623309 21:23625453-23625475 CTGCACATAATGTGGAATGATGG + Intergenic
1178724636 21:35040188-35040210 CTGCAGATGGTGTGGAATGAGGG + Intronic
1178741678 21:35207222-35207244 CTGCAGACCCTGAGTGCTGAGGG + Intronic
1180625967 22:17193708-17193730 CTGCAGAGACTGTGGGGTGAAGG + Intronic
1181160652 22:20957767-20957789 CTGCAGAGACTGGGGGCTGTGGG + Intergenic
1181390757 22:22579310-22579332 CTGCAGATGCTTCGGCATGAAGG + Intergenic
1182541543 22:31045632-31045654 TTGAAGGAACTGAGGGATGAGGG - Intergenic
1183331061 22:37221828-37221850 ATGCATTTACTGAGTGATGAAGG + Intergenic
1183618934 22:38961630-38961652 CTGCAAATGCTGCGGGATGCTGG + Exonic
1183624137 22:38991575-38991597 CTGCAAATGCTGCGGGATGCTGG + Exonic
1183997759 22:41648330-41648352 CAGCATGTACTGAGTGATGAAGG - Intronic
1184784570 22:46665475-46665497 CTCCAGACACTCAGGGATGAGGG - Intronic
1185097916 22:48821811-48821833 CTGCAGATATGGTGGGATGTGGG + Intronic
950312707 3:11973126-11973148 CTGCTGGTACTGATGGCTGAAGG + Intergenic
950801508 3:15555351-15555373 CTGCAAATATGGAGGGACGAGGG + Intergenic
951359419 3:21706951-21706973 CTACGCATACAGAGGGATGAAGG - Intronic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
953036686 3:39217681-39217703 TAGCATTTACTGAGGGATGAGGG - Intergenic
953461017 3:43081241-43081263 CTGCAGATCCTGATGGAGGGCGG - Exonic
953571230 3:44073322-44073344 CTGCAGCCCCTGAGGGGTGAGGG + Intergenic
953869793 3:46616297-46616319 CTGCAGAGTCTCAGGGATCATGG + Intronic
955817424 3:62860388-62860410 CTGCAGATACTGAGGGATGATGG - Intronic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
957526366 3:81383601-81383623 ATGCAGTTACTGAAGGAGGAGGG + Intergenic
959201113 3:103248983-103249005 CTGCAGACAATCAGGGATAATGG + Intergenic
960309161 3:116099153-116099175 CTGCAGATGCTTCAGGATGAAGG + Intronic
962033052 3:131621590-131621612 CTGCAGTATCTGAGGGATAATGG - Intronic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
965387323 3:168060325-168060347 CTGCAGTAATTGAGGCATGAGGG + Intronic
969588326 4:8107313-8107335 CTGCAGATGCTTTGGGAAGATGG - Intronic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
970769916 4:19599676-19599698 GTGCAGATACTGAGTCATGCTGG + Intergenic
971421241 4:26475919-26475941 TTGTACATAATGAGGGATGACGG - Intergenic
978069936 4:104454609-104454631 CTGCATGTTCTGAGGGATCAGGG - Intergenic
978890483 4:113820659-113820681 CTGCAGAGACAGAAGAATGAAGG + Intergenic
979703525 4:123694091-123694113 CCTTGGATACTGAGGGATGAGGG + Intergenic
981206754 4:142050776-142050798 CTGTAGGTACCAAGGGATGATGG - Intronic
984674899 4:182535630-182535652 CTCCAGAGACTGAGGTAGGAGGG + Intronic
984950596 4:185004844-185004866 CCGCAGATGCTGGGGGCTGAAGG + Intergenic
985004969 4:185525201-185525223 CTCAAGATACTGCGGGATGTTGG - Intronic
985019127 4:185669110-185669132 CTGGAGCTCCTGAGGAATGAAGG + Intronic
985642170 5:1068831-1068853 TTGCAGTGACTGGGGGATGACGG - Intronic
985841156 5:2306948-2306970 CTGCAGTTCCTGATGGGTGAAGG - Intergenic
986257943 5:6116626-6116648 GTGAAGATACTGAAGGATGATGG + Intergenic
986801942 5:11269780-11269802 CTGCATATTCTGAGGGGGGAGGG - Intronic
992382842 5:76255744-76255766 CAGCAGAACCTGAGGGGTGAGGG - Intronic
992885270 5:81152469-81152491 CTACAGATATTGAAGGAAGAAGG - Intronic
993501265 5:88670018-88670040 CTGCATATCCTGAGAGATGGTGG - Intergenic
995378677 5:111507993-111508015 CTGTAGACAATGAGGTATGATGG - Intronic
996310283 5:122096606-122096628 CTGCAGAGACAGAGGGATGGGGG - Intergenic
997147945 5:131457780-131457802 CCACAGATACTGAGGGACAATGG + Intronic
998133668 5:139663609-139663631 CTGGGGAAACTGAGGCATGAAGG + Intronic
998397464 5:141827911-141827933 CTGCAGAGACTGAGGCATGGAGG + Intergenic
1001085470 5:168697181-168697203 CTCCAGCTTCTGGGGGATGAAGG + Intronic
1001702402 5:173716590-173716612 CTGAACAGACTGAGGGATGGAGG - Intergenic
1001804448 5:174571241-174571263 CTGCAAATCCTGAGGCAAGAAGG - Intergenic
1002860085 6:1072433-1072455 CTGAAGATACTGAGGTCAGAGGG + Intergenic
1003460265 6:6322082-6322104 TGGCAGATACTTAGTGATGAAGG - Intergenic
1003472655 6:6451713-6451735 CTGCCTGTACTGAGGGATGCAGG - Intergenic
1005426335 6:25706630-25706652 CTCCAGATTCTGAGGCAAGAAGG + Intergenic
1007118636 6:39362335-39362357 CTGCAGCTACTCAGGGATGTGGG - Intronic
1007187019 6:39980551-39980573 CTGCTGATAGTGAGGGGAGACGG + Intergenic
1007378018 6:41469533-41469555 CTGCAGTCACTCAGGGAGGAGGG + Intergenic
1010673636 6:78716546-78716568 CTGCAGTTAATAAGAGATGAGGG - Intergenic
1011554320 6:88558751-88558773 GAGCAGATACTGAGAGCTGAGGG - Intergenic
1013432134 6:110064647-110064669 CTGCACACACTGAGGGTTGCAGG - Intergenic
1014987809 6:128033273-128033295 CAGGAGATACTGAGGTATAATGG + Intronic
1015579561 6:134708774-134708796 CTGCACATACTCAGTGAAGAAGG + Intergenic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1016630553 6:146225015-146225037 ATCCAGATGCTCAGGGATGATGG - Intronic
1018381200 6:163259858-163259880 CCCCAGAGGCTGAGGGATGAGGG + Intronic
1019845430 7:3495101-3495123 CTTCAGAGACTGACGGATGGTGG - Intronic
1020317571 7:6917342-6917364 CTGCAGGTAATGAGGATTGATGG - Intergenic
1020531819 7:9347747-9347769 CTGCAGAGACTGAAAGATAAGGG + Intergenic
1021038534 7:15831660-15831682 AGGCAAATATTGAGGGATGAGGG - Intergenic
1021040246 7:15853357-15853379 GAGCATATACTGAGGTATGAAGG + Intergenic
1021648110 7:22806793-22806815 CTGCAGACCCTGCGGGGTGATGG + Intergenic
1022033314 7:26512224-26512246 CTGAAGGTACTGAAGGAAGACGG + Intergenic
1022286889 7:28962076-28962098 CTTCAGCTACAGAGGTATGAAGG + Intergenic
1022304526 7:29134192-29134214 CTGCAGAGGCTGAAGAATGAAGG - Intronic
1022403844 7:30067746-30067768 CTGAAAATACTGAGTGAAGAAGG - Intronic
1023911562 7:44560251-44560273 CTGCAGGTTCTGATGGAAGAGGG + Intergenic
1024613826 7:51090403-51090425 CTGCAGACACTGAGCGATACTGG - Intronic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1026366054 7:69649597-69649619 CTGTAGATACATAGGAATGAGGG - Intronic
1029369295 7:100137880-100137902 TTGCAAAAACTGAGGGAGGAAGG + Intergenic
1029909740 7:104133022-104133044 GTGCAGATACCGAGGAAAGAAGG + Intronic
1031741746 7:125441341-125441363 CTGCAGCTACTGAGACAAGAAGG + Intergenic
1032318801 7:130866135-130866157 CTGCAGATTCTGTGGGATTATGG - Intergenic
1032802288 7:135326305-135326327 GTGCAGATACTGAGTTAGGATGG - Intergenic
1033426444 7:141249020-141249042 CTGCAGATAATGTGGGCTGTTGG + Intronic
1033507795 7:142023166-142023188 CTCCAGACACTGAGGTACGAGGG - Intronic
1035090258 7:156304556-156304578 CTGCAGATACAGAGCGAGAACGG - Intergenic
1035203653 7:157281361-157281383 CTGCAGAGACAGAGGGCAGATGG + Intergenic
1035681119 8:1488846-1488868 CTGCAGATAGTGGGGCATGCAGG + Intergenic
1036131959 8:6123780-6123802 CTGCAGAAACAATGGGATGATGG + Intergenic
1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG + Intergenic
1037219986 8:16507170-16507192 GTGCAGAAACTGAGGGGTGATGG + Intronic
1037623080 8:20584109-20584131 ATTCAGATACTGAGGGTGGAGGG + Intergenic
1037848198 8:22303501-22303523 CTCCAGAGACTGAGGGAGGTGGG - Intronic
1037889729 8:22617528-22617550 CTGTTGCTTCTGAGGGATGATGG + Exonic
1038047573 8:23778998-23779020 CTTCAGATAAAGAGGGACGACGG + Intergenic
1038559744 8:28562807-28562829 CTGCAGTTACAGAGGAATGGAGG + Exonic
1038599297 8:28923190-28923212 CTGCAGTTGCTAGGGGATGAGGG - Intronic
1039861028 8:41457823-41457845 CAGCATACACTGAAGGATGAAGG - Intergenic
1039913962 8:41846072-41846094 CTCCATAAACTGAGGGATGCTGG + Intronic
1041078510 8:54190925-54190947 CTACAGATCCTGAGGGATATTGG + Intergenic
1041301319 8:56414839-56414861 CAGCAGATATTGAGGGAGGGAGG - Intergenic
1042957812 8:74270946-74270968 CTGCAGCCACTGAGGAATGCAGG + Intronic
1043095771 8:75970191-75970213 ATGCAGAAACTCAGGGAGGAGGG - Intergenic
1048509935 8:135053171-135053193 CTGCAGATACAGAGGGCCAATGG - Intergenic
1048590741 8:135818479-135818501 CTGGAGGTCCTGAGAGATGAGGG + Intergenic
1048988150 8:139746421-139746443 CTGAAGAAACTGAGGGCTGGAGG + Intronic
1049808192 8:144550838-144550860 CTGGGGACACTGAGGGGTGAAGG + Intronic
1049867034 8:144946015-144946037 CTGCTGATAGTGAGGGCAGATGG + Exonic
1050541174 9:6671676-6671698 CTCCAGAGACTGAGGTAGGAGGG - Intergenic
1051548155 9:18299667-18299689 CTGCAGAACCTGGGTGATGAAGG + Intergenic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1055840787 9:80500585-80500607 ATGAAGACACTGAGGGCTGAAGG + Intergenic
1185528796 X:800657-800679 GTGTAAACACTGAGGGATGATGG + Intergenic
1186046144 X:5538442-5538464 CTGCAGATTCTGAGAGAAGAGGG - Intergenic
1187307983 X:18114433-18114455 GTGCAGGTTCTGAGGCATGATGG - Intergenic
1187472616 X:19582445-19582467 CTGAAGATACCGAGGAAGGAGGG - Intronic
1191883168 X:65862654-65862676 TTGCAGACATTGAGGGATGACGG + Intergenic
1192833002 X:74769724-74769746 CTGGAGTTACTGAAAGATGAGGG + Intronic
1195307826 X:103603131-103603153 CTTCAGAGGCTGAGTGATGAGGG + Intergenic
1196563325 X:117176833-117176855 CTGCAGATCCTGTTGGGTGATGG + Intergenic
1199482976 X:148318222-148318244 TAGTAGATACTGAGGGCTGAGGG + Intergenic
1201975339 Y:19842926-19842948 CTTCAGAGTCTGAGAGATGAAGG + Intergenic