ID: 955817525

View in Genome Browser
Species Human (GRCh38)
Location 3:62861139-62861161
Sequence TAGGTCAGCTGGAAGCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955817522_955817525 -9 Left 955817522 3:62861125-62861147 CCATCTGCATCCTTTAGGTCAGC 0: 1
1: 0
2: 1
3: 8
4: 163
Right 955817525 3:62861139-62861161 TAGGTCAGCTGGAAGCCAGATGG 0: 1
1: 0
2: 0
3: 30
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955817525 Original CRISPR TAGGTCAGCTGGAAGCCAGA TGG Intronic
900327037 1:2113449-2113471 CAGGGCAGGTGGAAGCCAGCAGG + Intronic
900482747 1:2907183-2907205 TAGGAGAGCTGGAAGCCGGTGGG + Intergenic
902229959 1:15021586-15021608 GAGGTCACCTGGAAGCCAGGAGG - Intronic
902353431 1:15877356-15877378 GAGGACTGCTGGAACCCAGAAGG - Intronic
902512400 1:16973524-16973546 TCGGTCAGCTGGACTCCAGCAGG - Intergenic
902891735 1:19449042-19449064 TGGGTCAGATGGAAACCAGATGG - Intronic
906171791 1:43732257-43732279 GATCCCAGCTGGAAGCCAGAAGG - Intronic
909484116 1:76154893-76154915 TAGGTCATCTGGCAGCCACTGGG + Intronic
910821446 1:91353728-91353750 TAGGTTAGGAGGAAGCAAGATGG + Intronic
911260623 1:95680995-95681017 TACCTCAGCTGGAATTCAGATGG - Intergenic
912951397 1:114123047-114123069 AAAGTCAGCTGGAAGCAAAAAGG - Intronic
914259246 1:145985117-145985139 TAGGTCACCTGGAAGGTGGAAGG - Intergenic
914354152 1:146867836-146867858 CAGATCATCTGGAAGGCAGAAGG + Intergenic
914571883 1:148924977-148924999 TAGGATAGCTGAAATCCAGAAGG - Intronic
914600953 1:149205283-149205305 TAGGATAGCTGAAATCCAGAAGG + Intergenic
915103915 1:153520493-153520515 TGGGACAGCTTGAAGCAAGAAGG + Intergenic
917269533 1:173258119-173258141 GAAGTCTGCTGGAAGCCAAATGG - Intergenic
921684236 1:218071665-218071687 TGGTTCAGATGGAAACCAGATGG - Intergenic
922762525 1:228141630-228141652 TAGGATGGCTGGAAGCCAGAAGG + Intronic
923173950 1:231445446-231445468 TCGGACAGCTGGGAGCAAGATGG - Intergenic
923224032 1:231922734-231922756 TATCTCACCTGGAACCCAGAGGG - Intronic
923516851 1:234704931-234704953 TAGGTCATCTGAGAGACAGAAGG - Intergenic
1062956636 10:1544484-1544506 TGGGTCCTCTGGAATCCAGAAGG - Intronic
1063239377 10:4152711-4152733 CTGGTCAGCAGGAAGCCACATGG - Intergenic
1064327817 10:14366930-14366952 ATGGTCAGCTGGAGGCCAGATGG - Intronic
1064516564 10:16155544-16155566 TAGGTCATCAGGAAGCCTGGGGG + Intergenic
1068296820 10:55081138-55081160 GAGATCAGCTGGGAGCCTGAAGG - Intronic
1069256176 10:66334595-66334617 GAGGTCAGCTGTAAGTCTGATGG + Intronic
1069713613 10:70506813-70506835 CAGGTCAGAAGGAAGACAGAGGG - Intronic
1070557053 10:77536706-77536728 TCTGTCAGCTGGAAGCAAAAAGG + Intronic
1072447096 10:95508713-95508735 TAGAGCAGTTGGAAGCCACACGG - Intronic
1073466697 10:103698403-103698425 AATGTCAGCTGGCAGACAGAAGG - Intronic
1076077446 10:127546201-127546223 TAGGTCATCTGGAAGCTGGTAGG + Intergenic
1077231172 11:1458783-1458805 AAGGGCAGCCGGAAGCCACAGGG + Intronic
1078956671 11:16204816-16204838 TAAGAAAGCTGAAAGCCAGAGGG + Intronic
1080520033 11:33060658-33060680 GAGGGCTGCTGAAAGCCAGATGG + Intronic
1082014585 11:47475339-47475361 TGGTGCTGCTGGAAGCCAGAAGG - Exonic
1083799483 11:65038272-65038294 TAGGTCAACTGGAGTCAAGAGGG + Intronic
1084118012 11:67053088-67053110 TACGCCAGGTGGAAACCAGAGGG - Intergenic
1085547787 11:77336376-77336398 TAGCAGAGCTGGAAGCCAGGCGG - Intronic
1088244905 11:107808280-107808302 TTGCTCATCTGGAAGGCAGAGGG + Intronic
1088889927 11:114036325-114036347 TCCGTCCGCTGGAGGCCAGAAGG - Intergenic
1092111708 12:5969246-5969268 CAGCTCAGCTGAAAGCCCGAGGG + Exonic
1092123954 12:6063047-6063069 GAGGTCACCTGGAACCCAGCAGG + Exonic
1095539377 12:43290781-43290803 TAAGTCAGTCGGAAGCCAAAAGG + Intergenic
1096119484 12:49078505-49078527 AAAGCTAGCTGGAAGCCAGAGGG - Intergenic
1097220942 12:57450678-57450700 GACCTCAGCAGGAAGCCAGAGGG - Exonic
1097459738 12:59846389-59846411 CAGGACAACTCGAAGCCAGATGG + Intergenic
1098052686 12:66471051-66471073 AAACTCAACTGGAAGCCAGAAGG + Intronic
1098755965 12:74364413-74364435 TAGATCAGCTGGGAGTCACAAGG + Intergenic
1102295535 12:111733738-111733760 GAGTCCAGCTGGAAGCCAGAGGG + Intronic
1102735375 12:115154372-115154394 TAGGCCAGCTGGGTGCCAGGTGG + Intergenic
1103960288 12:124605271-124605293 CAGGCCAGCTGGAGGCCAAATGG + Intergenic
1104483939 12:129133116-129133138 AAGGACAGCAGGAAGCAAGAAGG - Intronic
1107784009 13:43936088-43936110 TTTGTCAGCTGGAAGGCAGAAGG - Intergenic
1110011676 13:70342899-70342921 AAGATCAGCTGGAAGACATAGGG + Intergenic
1110467861 13:75823660-75823682 TAGATAAGCTTGAAGCCAGTTGG - Exonic
1110705136 13:78596249-78596271 TCGGGCAGCTGGAAGCCTGTGGG + Intergenic
1110723009 13:78786736-78786758 GAGGTCAGCTGGCATCCAAAGGG + Intergenic
1111294702 13:86263737-86263759 TATGTCAGCTGGGACCAAGAGGG - Intergenic
1112206418 13:97328068-97328090 TATGGCAGCTGGAAGCCACAAGG + Intronic
1115202507 14:30869936-30869958 TGGGACAGCTGGGAGCCAGCTGG + Intergenic
1121690049 14:95871725-95871747 CTGGTTAGCAGGAAGCCAGAAGG - Intergenic
1122821578 14:104348934-104348956 CAGGTCAGCTGCGAGCCAGAAGG + Intergenic
1128759792 15:70208641-70208663 GAACCCAGCTGGAAGCCAGAGGG + Intergenic
1132245804 15:100295336-100295358 GAGCTCAGCAGGAAGCCAGCTGG - Intronic
1133224311 16:4333340-4333362 GAGTTCAGCAGGAAGCCTGAGGG - Exonic
1133546620 16:6813843-6813865 GAGCTCAGATGGAAGCCAGAGGG - Intronic
1133653391 16:7834777-7834799 GGGCTCAGCTGGAAACCAGAAGG - Intergenic
1135124045 16:19792002-19792024 TATGTCAGCTGGGACCAAGAGGG + Intronic
1135772275 16:25226715-25226737 TAGGTCAGCTTGACTCCAAAAGG + Intronic
1136107788 16:28042891-28042913 TAGGTGAAGTGGAAGCCAAATGG + Intronic
1138274288 16:55720759-55720781 TAGGTCTGCTGCTAGCCTGATGG - Intergenic
1138554424 16:57763474-57763496 TAGGTCAGGAGGAGGCCAGGTGG - Intronic
1139469984 16:67173240-67173262 CAGGTCAGCAGGGAGCCAGGTGG + Intronic
1139979865 16:70847701-70847723 CAGATCATCTGGAAGGCAGAAGG - Intronic
1140259558 16:73365709-73365731 TTGGTGAGCTGGGGGCCAGAGGG - Intergenic
1140752860 16:78041894-78041916 CACTTCAGCTGGAAGCCAGAAGG + Intronic
1141443301 16:84042912-84042934 GAGCTCAGCTGGGAGCCACACGG + Intergenic
1141521174 16:84580644-84580666 GTGTTCAGGTGGAAGCCAGATGG - Intronic
1141662375 16:85448408-85448430 GAGGCCAGCTGCAAGCCAGGAGG + Intergenic
1142599706 17:1047605-1047627 CAGGTCAGCTGGCAGCAGGAAGG + Intronic
1143172558 17:4938587-4938609 CTGGTCAGCTGGAAGCCTGGTGG + Exonic
1143993294 17:10985487-10985509 AAAGTCAGCTCGAAGACAGATGG - Intergenic
1144739676 17:17574840-17574862 CAGGCCTGCAGGAAGCCAGAGGG + Intronic
1145777264 17:27538112-27538134 TAGGTTTTCTGGAAGCCAGCAGG + Intronic
1145919430 17:28599272-28599294 GAGGTCCGCTGGAAGCAGGAGGG - Exonic
1146065301 17:29630359-29630381 AAGGTCAGCCAGAAGTCAGAGGG - Exonic
1147661684 17:42120363-42120385 GTGGTCAGCTGCAAGACAGATGG + Exonic
1148351294 17:46943698-46943720 CAGGCCAGGAGGAAGCCAGAAGG + Intronic
1148851520 17:50557846-50557868 TAGCTCCGCAGGGAGCCAGATGG + Intergenic
1149078904 17:52630791-52630813 AAGGTCCGCTGCCAGCCAGATGG - Intergenic
1152283879 17:79401340-79401362 TAGGTCAACTTCAAGCCAAATGG + Intronic
1152612719 17:81323495-81323517 GAGGTCAGCTGGAGGTCAGAAGG + Intronic
1152800741 17:82329642-82329664 TAGATTAGCTGGAAGTCCGACGG + Intronic
1155346214 18:24859754-24859776 GAAGCCAGCTGGAAGCCTGAGGG + Intergenic
1155482503 18:26303816-26303838 TAAATCAGCTGGAAGACAGTGGG - Intronic
1156008660 18:32471292-32471314 TGGGTCACCGGGAAGCAAGAGGG - Intergenic
1156467860 18:37359309-37359331 TGGCTCTGCTGGAATCCAGATGG - Intronic
1158992831 18:62887825-62887847 GAGGACAGCTTGAACCCAGAAGG - Intronic
1159803698 18:72929128-72929150 CAGATCAGGTGGCAGCCAGATGG + Intergenic
1160348909 18:78158007-78158029 AAGGTCAGGTGGAGACCAGAGGG - Intergenic
1160423725 18:78766744-78766766 TGGGTCACCTGGAAATCAGAAGG + Intergenic
1161487151 19:4542683-4542705 ATGGTCAGCTGGAGGTCAGAGGG + Exonic
1162717685 19:12644226-12644248 TAGGTCAGCTAGGAACCATAGGG - Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1166909827 19:46145545-46145567 GAGGGAAGCTGGAAGCAAGATGG - Intronic
1167571518 19:50292010-50292032 GAAGGCAGCTGGAAGCCTGATGG - Intronic
1167618820 19:50550257-50550279 AAGGAGAGCTGGGAGCCAGAGGG - Intronic
1168309556 19:55453486-55453508 TTGGGCAGCTGCTAGCCAGAAGG - Intronic
1168551955 19:57303331-57303353 AAGATCAGCTGAAAACCAGAAGG - Intergenic
926007807 2:9386211-9386233 TAGGTCAGTAGGTAACCAGATGG + Intronic
926725947 2:15998062-15998084 GAGGCCACCTGGGAGCCAGAAGG - Intergenic
932130263 2:69181139-69181161 TAGGGCAGCAGGAGGCCAGTTGG + Intronic
932360541 2:71102044-71102066 TCTTTCTGCTGGAAGCCAGAAGG - Intergenic
932527861 2:72491348-72491370 AAAGACAGCTGGAAGCCAGGTGG - Intronic
933633539 2:84682555-84682577 CAGGCCAGCTGGATGCCTGAGGG - Intronic
935090516 2:99891056-99891078 AAGGTCAGCTGGGAGGTAGAGGG + Intronic
936491091 2:112972775-112972797 AAGGGCAACTAGAAGCCAGAAGG - Intergenic
936835027 2:116699263-116699285 TAGTCCACCTGGAAGCCAGGAGG + Intergenic
937184343 2:120025742-120025764 TAGGTCAGCTGGAATTCTCATGG - Intronic
937292921 2:120792928-120792950 TAGATTATTTGGAAGCCAGAAGG + Intronic
937990582 2:127659868-127659890 CAGCACAGCTGGAAGCCAGAGGG - Intronic
941932394 2:170955124-170955146 AAGCTCAGCAGGAGGCCAGAGGG + Intronic
943375812 2:187075314-187075336 TGCGTCACCTGGAAGCAAGAGGG - Intergenic
944847204 2:203680964-203680986 GAGCCCAGCTGGAAGCCAGAAGG + Intergenic
944867210 2:203874394-203874416 TAGTTCATTTGGAAGCCACAGGG - Intergenic
945331373 2:208542947-208542969 TAGCTGAGCTGGCAGCCAGTTGG + Intronic
946426401 2:219600150-219600172 GAGAACAGCTGGAAGCCAGGAGG - Intronic
946661864 2:222009435-222009457 TATGTCACCTGGGAGCAAGACGG + Intergenic
946875197 2:224122626-224122648 TAGGTCAGCTAGAATGCATAAGG - Intergenic
947581000 2:231318506-231318528 GGGGACAGCTGGAAGCAAGAGGG - Intronic
948362748 2:237434325-237434347 TAAGACAGGTGTAAGCCAGAGGG + Intergenic
1168734379 20:117584-117606 TAAGTCTGCTGTTAGCCAGATGG - Intergenic
1169752011 20:9004217-9004239 TCTATCAGCTGGAACCCAGAAGG + Intergenic
1170593727 20:17790301-17790323 TATCTGAGCTGGAGGCCAGAAGG + Intergenic
1171237451 20:23539188-23539210 AAACTCAACTGGAAGCCAGAAGG + Intergenic
1172645158 20:36464470-36464492 GAGGACAGCTTGAATCCAGAAGG + Intronic
1172665806 20:36598950-36598972 AAGCTAAGCTGGCAGCCAGAGGG - Intronic
1172781932 20:37441862-37441884 AAGCCCAGCTGGAAGCCAGAGGG + Intergenic
1173287896 20:41689495-41689517 TAGATCAGGTGGTGGCCAGATGG + Intergenic
1173603038 20:44309786-44309808 TAGGTGAGCTGGGAGCCAAGTGG - Intronic
1173654448 20:44690100-44690122 ACTGTCAGCTGGAAGCCAGCAGG + Intergenic
1174729323 20:52899397-52899419 CAGGTCAGAAGGAAGACAGATGG + Intergenic
1175088880 20:56485453-56485475 AAGAGCAGCAGGAAGCCAGAAGG + Intronic
1175523521 20:59618230-59618252 CAGGGGAGCTGGGAGCCAGACGG + Intronic
1176837083 21:13803202-13803224 TTGATCAGCTCGAACCCAGAAGG + Intergenic
1178193445 21:30314626-30314648 TAGGTCAGCTGAAAGCCAAGAGG - Intergenic
1178425474 21:32475773-32475795 GAAGTCAGCTGGAAGTCAGCCGG - Intronic
1178842818 21:36151564-36151586 CAGGACAGCTGGAAGCCTGGAGG - Intergenic
1180675860 22:17586108-17586130 GAGGTGACCTGGAAGCCTGAGGG + Intronic
1180855556 22:19042628-19042650 TAGGGCATCAGGAAGCCAGGAGG + Intronic
1182519906 22:30879320-30879342 TTGGCAAACTGGAAGCCAGATGG + Intronic
1182776961 22:32838383-32838405 AGGGGCAGCTGGAGGCCAGAGGG + Intronic
1182885428 22:33769813-33769835 AGAGACAGCTGGAAGCCAGAAGG - Intronic
1183440638 22:37821228-37821250 TAGTCCAGCTGGAGCCCAGATGG - Intergenic
1184991386 22:48172496-48172518 TAGGTGGGCTGGCAGGCAGAGGG - Intergenic
1185306263 22:50118801-50118823 GAGATCAGCTGGAACCAAGATGG - Intronic
949902079 3:8823961-8823983 TAACCCAGCTGGAAGCCAGAGGG - Intronic
952857259 3:37782576-37782598 AAGTTGACCTGGAAGCCAGATGG + Intronic
953614688 3:44478928-44478950 CAACTCAACTGGAAGCCAGAGGG + Intergenic
953782638 3:45885047-45885069 TAGGTCATCTGAAAGGTAGAGGG - Intronic
955316064 3:57940205-57940227 GGGGTCAGCTGGAAAGCAGAGGG + Intergenic
955817525 3:62861139-62861161 TAGGTCAGCTGGAAGCCAGATGG + Intronic
956188328 3:66583540-66583562 TGGGTCAGATAGAAACCAGATGG - Intergenic
956485618 3:69719098-69719120 TAAATCACCTGGAAGCCCGAGGG + Intergenic
956731852 3:72203781-72203803 CAACCCAGCTGGAAGCCAGATGG + Intergenic
959477778 3:106832349-106832371 TAGGCCAACAGGAAGCCAGGTGG + Intergenic
961216044 3:125161486-125161508 CAGGTCAGTTGGAATCCAGTTGG - Intronic
961325430 3:126106598-126106620 GAGGCCAGGTGGAAGCCAAAAGG - Intronic
962826747 3:139105910-139105932 TTGGTCAGCTGCATTCCAGAGGG - Intronic
967633231 3:191771603-191771625 TAGGGAATCTGGAAGGCAGAAGG - Intergenic
968111013 3:196046720-196046742 TAGGATAGCTGGAATCCAGGAGG + Intronic
969060985 4:4434316-4434338 TATAGCAGCTGGAAACCAGAAGG + Intronic
969092628 4:4706648-4706670 GAACCCAGCTGGAAGCCAGAGGG + Intergenic
970798554 4:19945007-19945029 AAAGCCAGCTGGAAGCCAGAGGG + Intergenic
971053288 4:22885310-22885332 TATCCCACCTGGAAGCCAGATGG + Intergenic
973256278 4:48116747-48116769 TAACCCAGCAGGAAGCCAGATGG + Intronic
974234454 4:59162673-59162695 GAGGTCTGCTGCTAGCCAGATGG - Intergenic
975437090 4:74365387-74365409 TGGGGCGGCCGGAAGCCAGAGGG - Intronic
978104876 4:104889810-104889832 TTGGTCAGATGGAAACAAGAAGG - Intergenic
978835058 4:113139324-113139346 TCGATCAGCTGGTTGCCAGATGG + Intronic
978912444 4:114080124-114080146 GAGGTCAGCTGGAGACCAGAAGG + Intergenic
979026567 4:115584829-115584851 TCTGTCATCTGAAAGCCAGAAGG - Intergenic
983801266 4:171932447-171932469 CAGGGAAGCTGGAAGCCAGTGGG + Intronic
986266019 5:6191032-6191054 AAGCCCAGCTGGAAGCCAGAGGG - Intergenic
989777553 5:45226890-45226912 CAAGTCAGCTGGAAGCTAGCTGG + Intergenic
990977378 5:61571666-61571688 TGGGTCTGCAGGATGCCAGATGG + Intergenic
993944629 5:94102797-94102819 AAGGTCAGCTGTTAGCCTGATGG - Intronic
998582092 5:143387166-143387188 TAGAAAGGCTGGAAGCCAGAAGG - Intronic
998880180 5:146637544-146637566 TTGTTCAGATGGAAGGCAGAAGG - Intronic
1000742311 5:164985206-164985228 TTGGAGAGCTGGAAGCCACAGGG - Intergenic
1001631639 5:173179746-173179768 AAGGTCAGCAGGAAGCAAAAAGG - Intergenic
1002386316 5:178869809-178869831 TTTGTCAGATGGAAGTCAGATGG + Intronic
1002469336 5:179426122-179426144 GAGCCCAGCTGGAAGTCAGAGGG - Intergenic
1003340405 6:5214693-5214715 TACGCCAGCTTGCAGCCAGATGG + Intronic
1003619438 6:7685039-7685061 AAGCTCAGCGGGGAGCCAGACGG - Intergenic
1004474892 6:15962111-15962133 AAGGGCAGCAGGTAGCCAGAAGG - Intergenic
1006506378 6:34491382-34491404 TAGGAGAGCTGGAACCCAGCAGG - Intronic
1006925174 6:37650047-37650069 CAGGCCGGCTGGGAGCCAGAAGG + Intronic
1007201075 6:40109607-40109629 AAGCCCAGCTGGAAGCCAAAAGG - Intergenic
1007256859 6:40535630-40535652 TGGGTCAGCTGGAGGGCAGGAGG - Intronic
1007293263 6:40802622-40802644 TGGGCCATCAGGAAGCCAGAGGG + Intergenic
1009889064 6:69658047-69658069 GAGGTCAGCTGTTAGCCTGATGG - Intergenic
1010355310 6:74925711-74925733 GAGCCCAGCTGGAAGCCAGAGGG - Intergenic
1012215102 6:96572802-96572824 GGGATCAGCTGGAAGCCAGGAGG - Intronic
1012604810 6:101144791-101144813 CAGGCAAACTGGAAGCCAGAGGG + Intergenic
1012952198 6:105530178-105530200 CAGTTCATCTGGAAGCCAGAGGG + Intergenic
1014121360 6:117729060-117729082 TAGCTTAGCTGGAAACCATAAGG + Intergenic
1014343122 6:120233355-120233377 AAGATCAGCTGGAAGCCCTAAGG + Intergenic
1015508896 6:134017977-134017999 TAGGTCACCTGCAGTCCAGAGGG - Intronic
1015557950 6:134482343-134482365 CACGCCAGCTGGAAGGCAGAGGG + Intergenic
1015635648 6:135271413-135271435 TCTACCAGCTGGAAGCCAGAAGG + Intergenic
1017352381 6:153457812-153457834 AAGGTCTGCTGTAAGCCTGATGG + Intergenic
1018356753 6:163025785-163025807 GAGCTGAGCTGGAAGCCAGGGGG + Intronic
1018484642 6:164228390-164228412 TAGTGCAGGTGGAAGTCAGAAGG + Intergenic
1018595761 6:165478931-165478953 TAGGACAGCTGGAAGCATGGGGG - Intronic
1021586167 7:22211135-22211157 TAGGACTGCTGGATGCCAGATGG + Intronic
1022756688 7:33300274-33300296 AAACTCAACTGGAAGCCAGAGGG + Intronic
1024216972 7:47256120-47256142 CAGGTCAGATGGGAGCCACAAGG + Intergenic
1024321361 7:48074564-48074586 GAAGTCAGCTGGTTGCCAGAAGG - Intergenic
1026763480 7:73144175-73144197 AAAGTCAGCTGGAAGCCACATGG - Intergenic
1027039950 7:74953949-74953971 AAAGTCAGCTGGAAGCCACATGG - Intergenic
1027083689 7:75248415-75248437 AAAGTCAGCTGGAAGCCACATGG + Intergenic
1027709964 7:81587845-81587867 TAGGTTAGCTGGAAGATAAATGG - Intergenic
1028182029 7:87735391-87735413 AAGATCAGCTGGAAGCTAGATGG - Intronic
1028990652 7:97045707-97045729 TAGGTCAGCTGGAGGCTGGCTGG - Intergenic
1029391291 7:100276265-100276287 AAAGTCAGCTGGAAGCCACATGG + Intergenic
1030694726 7:112572315-112572337 GAACTCAGCTGTAAGCCAGAGGG + Intergenic
1031723928 7:125212365-125212387 TATGTCCGCTGGAAGTCAAAGGG + Intergenic
1033000140 7:137494451-137494473 AAGGTCAGCTGTTAGCCTGATGG - Intronic
1033502948 7:141972010-141972032 TAGGTGACCTGGATGCCAGTAGG - Intronic
1034189951 7:149206421-149206443 TAGGTCAACTGGATACCTGAGGG - Intronic
1034698025 7:153071931-153071953 TAGGAGAGCTGGATGTCAGAAGG - Intergenic
1035427923 7:158794266-158794288 GAGGACTGCTTGAAGCCAGAAGG + Intronic
1035712346 8:1728234-1728256 TAGGGCAGCTGGAGGGCAGGTGG + Intergenic
1036574836 8:10017818-10017840 CAGGGCAGCTGTAAGCAAGACGG + Intergenic
1040008449 8:42640815-42640837 AAGCCCAGCTGGAAACCAGAGGG + Intergenic
1043301776 8:78743678-78743700 GAGGTCAGCTGGAGGAAAGAGGG + Intronic
1043926314 8:86040898-86040920 TGGGTGAGCTGGCAGCCAGTGGG - Intronic
1044274068 8:90279965-90279987 TGGGACAACTCGAAGCCAGAGGG + Intergenic
1044915883 8:97112422-97112444 GAAGTCAGCTGGAAGCCATGAGG + Intronic
1047062246 8:121240693-121240715 TAGGTCATCTGGGAACCAGTTGG + Intergenic
1047865138 8:129015231-129015253 TAGTTCAGTTGGAAGTCAGGTGG + Intergenic
1048220011 8:132532523-132532545 TTTGTCAGCTGGAAGCCCGGAGG + Intergenic
1051898412 9:22012392-22012414 TAGGTGAGCTGGAAGAGTGAAGG - Intronic
1052489813 9:29151041-29151063 GAGGTCTGCTGCAAGCCTGATGG - Intergenic
1056466483 9:86860776-86860798 TAGGTCAGTTTTAAGGCAGAAGG + Intergenic
1056697310 9:88870861-88870883 CACAGCAGCTGGAAGCCAGAGGG + Intergenic
1058284050 9:103153629-103153651 GATGTCAGCTGGAAGCTGGAGGG + Intergenic
1058425452 9:104871701-104871723 GAGGACAGCTGGAAGACAAAAGG + Intronic
1058982923 9:110186800-110186822 AAGGTCAGAGGGGAGCCAGAGGG + Intergenic
1059585242 9:115598949-115598971 TAGCCCAGCTGGACCCCAGAAGG + Intergenic
1060439798 9:123627821-123627843 GAGGCCAGCAGGAAACCAGAGGG + Intronic
1060617762 9:125034226-125034248 TAGCCCAGCTGGAAGACAGAGGG + Intronic
1062005410 9:134236331-134236353 GAGGTCAGCTTCAAGGCAGATGG - Intergenic
1187032092 X:15498486-15498508 CAGGTCAGCCACAAGCCAGAAGG + Intronic
1187631629 X:21179228-21179250 TGGATAAACTGGAAGCCAGATGG + Intergenic
1189307453 X:39997545-39997567 TATGAGGGCTGGAAGCCAGAGGG - Intergenic
1189425657 X:40897532-40897554 AAGGTCAACTGGAAGGCAGAGGG - Intergenic
1191692693 X:63957295-63957317 TAAGTCCTCTGGAAGCTAGAGGG + Intergenic
1192197447 X:69038078-69038100 GAGGTAAGCTGGAAGATAGAGGG - Intergenic
1192763325 X:74118875-74118897 TAGGTACACTGGAAGCCAGAAGG - Intergenic
1193444031 X:81577663-81577685 TGGGTGCACTGGAAGCCAGAAGG - Intergenic
1201501737 Y:14650894-14650916 TAGGTAATCTGGAGGACAGAAGG - Intronic