ID: 955818776

View in Genome Browser
Species Human (GRCh38)
Location 3:62874801-62874823
Sequence GAGCAGCGGCGGCGGGGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1018
Summary {0: 1, 1: 2, 2: 11, 3: 129, 4: 875}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955818776_955818789 14 Left 955818776 3:62874801-62874823 CCCCGGCCCCGCCGCCGCTGCTC 0: 1
1: 2
2: 11
3: 129
4: 875
Right 955818789 3:62874838-62874860 GCCGCCGCCTGCACCCACCCCGG 0: 1
1: 0
2: 2
3: 40
4: 353
955818776_955818792 20 Left 955818776 3:62874801-62874823 CCCCGGCCCCGCCGCCGCTGCTC 0: 1
1: 2
2: 11
3: 129
4: 875
Right 955818792 3:62874844-62874866 GCCTGCACCCACCCCGGCTCCGG 0: 1
1: 0
2: 2
3: 28
4: 338
955818776_955818794 26 Left 955818776 3:62874801-62874823 CCCCGGCCCCGCCGCCGCTGCTC 0: 1
1: 2
2: 11
3: 129
4: 875
Right 955818794 3:62874850-62874872 ACCCACCCCGGCTCCGGCGCCGG 0: 1
1: 0
2: 1
3: 13
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955818776 Original CRISPR GAGCAGCGGCGGCGGGGCCG GGG (reversed) Exonic
900274188 1:1812835-1812857 GAGCAGTGGAGGTGGGGCTGGGG - Intronic
900344709 1:2205194-2205216 GAGGAGCGGGGGCGGGGCGTAGG - Intronic
900349594 1:2228303-2228325 GAGGAGCGGGGGCGCGGGCGCGG - Intergenic
900507735 1:3038150-3038172 GAGCAGCGGCAGAGGTTCCGAGG + Intergenic
900513367 1:3070416-3070438 GAGCCGCGCTGGCCGGGCCGCGG - Intronic
901086042 1:6613255-6613277 GAGTAGGGGCGGCAGGGGCGGGG - Intronic
901242873 1:7704966-7704988 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
901279933 1:8026162-8026184 GAGGAGCGGCGGCTGCCCCGCGG + Exonic
901373066 1:8817243-8817265 GCGCGGAGGCTGCGGGGCCGCGG + Exonic
901433877 1:9234716-9234738 GCGCGGCGGGGGCGGGGGCGGGG - Intergenic
901443648 1:9293622-9293644 GAGAAGCCGCGGCGGCTCCGGGG - Intronic
901726937 1:11249983-11250005 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
902286200 1:15410066-15410088 GGGCAGCGGCGGCGGCGGCGGGG + Exonic
902323647 1:15684496-15684518 GGGAAGCGGCGGCGGGGCGGCGG + Exonic
903034480 1:20485443-20485465 GGTCAGCGGCGCTGGGGCCGGGG + Exonic
903132731 1:21290232-21290254 GCGCGGCGGCGGCGGCGCCAGGG - Intronic
903155567 1:21440276-21440298 GAGGCGCGGCGGCGCGGCTGCGG + Intronic
903350088 1:22711716-22711738 GCGCCGCGGCCGCGGGGCGGTGG - Intronic
903652384 1:24929972-24929994 AAGCAGAAGCGGCGGGGCCCGGG + Intronic
903742499 1:25566530-25566552 GAGCAGCGGGGGTGGGGGTGGGG - Intronic
903907539 1:26696958-26696980 GAGCGGCGGCGGCGGGGGCCTGG + Exonic
903976761 1:27155052-27155074 GAGGAGCTGCAGCTGGGCCGGGG - Intronic
904011463 1:27392708-27392730 GACCAGGCGCGGCCGGGCCGCGG - Exonic
904027562 1:27514085-27514107 GAGCAGCAGCAGCTTGGCCGGGG + Intergenic
904171041 1:28592427-28592449 GGGCGGCGCCGGCGGGGCCCCGG + Intronic
904479216 1:30783577-30783599 GGGCTGCGGCGGCTGAGCCGTGG - Intergenic
905214539 1:36397621-36397643 GAGCAGCGGGAGCGGGTCTGGGG + Intronic
905273927 1:36805141-36805163 GAGAAGTGGTGGCGGGGCAGCGG - Exonic
905369204 1:37474401-37474423 GCGCAGCGGCCGCGGGGGCGGGG + Intergenic
905449325 1:38046762-38046784 GCGGAGCGGCGGCGGCGGCGCGG - Exonic
905580768 1:39081597-39081619 GCGCAGCGGCGGCTGGGGAGCGG + Intronic
905617105 1:39408921-39408943 GCCCGGCGGGGGCGGGGCCGGGG - Intronic
905639148 1:39576587-39576609 GCGCTGCGGCGGCGGGCGCGGGG + Intronic
905847115 1:41242243-41242265 GAGGCGCGGGGGAGGGGCCGGGG - Intergenic
906140595 1:43531539-43531561 GTGCGGCGGGGGCGGGGGCGCGG - Intronic
906534495 1:46544100-46544122 GCGCAGGGGCGGGGGGGCCCAGG - Intergenic
906551230 1:46668118-46668140 CAGCAGCGGGGTCGGGGCCGAGG - Exonic
906624485 1:47313980-47314002 GAGAGGCGGCAGCGGGGCCCTGG - Intronic
906627022 1:47333819-47333841 CAGCCACGGCGGCGGGGCCGCGG + Exonic
906640728 1:47439068-47439090 GAGGCGCGGCGGCGCGGCCTGGG - Exonic
906917186 1:50023989-50024011 GCGCCGCGGGGGCGGGGCCTTGG - Intergenic
906956881 1:50381902-50381924 CAGCAGGGGCGGCCGGGCAGAGG - Intergenic
907278088 1:53327951-53327973 GAGACGCGGCGGCGGCGGCGCGG - Exonic
908780300 1:67684999-67685021 GAGCCGAGGGGGCGGGGGCGGGG - Intergenic
910200114 1:84690467-84690489 CCGCAGCGGAGGAGGGGCCGCGG - Exonic
910449080 1:87328810-87328832 GAGGAGCGCGGGCGGGGGCGGGG + Exonic
911017243 1:93346190-93346212 CGGCAGCGGCAGCGGGGCCTCGG + Exonic
912246322 1:107965070-107965092 CTGCAGCGGCGGCCGGGTCGCGG - Exonic
912381299 1:109249606-109249628 CAGCAGCCGCGGCGGGGACGCGG + Intergenic
912790058 1:112640651-112640673 CAGCAGGGGCGGCCGGGCAGAGG - Intronic
912990299 1:114479910-114479932 CAGCAGGGGCGGCCGGGCAGAGG - Intronic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913109093 1:115641971-115641993 GTGCAGCGGCGGCGGCGGCGGGG + Exonic
913144515 1:115976488-115976510 AAGCGCTGGCGGCGGGGCCGGGG - Exonic
913144589 1:115976723-115976745 GAAATGCGGCTGCGGGGCCGCGG - Intronic
913161852 1:116152289-116152311 GGGCGGAGGCGGCGGGGCTGCGG - Intergenic
913680749 1:121185853-121185875 GAGCAGAGGCGGCGGGGTTCAGG - Intronic
913959459 1:143327601-143327623 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
913979476 1:143497120-143497142 AAGCCGCGGCGGCGGGGGGGCGG - Intergenic
914032581 1:143973495-143973517 GAGCAGAGGCGGCGGGGTTCAGG - Intergenic
914044327 1:144078004-144078026 AAGCCGCGGCGGCGGGGGGGGGG - Intergenic
914053819 1:144153174-144153196 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
914125327 1:144813191-144813213 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
914133784 1:144882683-144882705 AAGCCGCGGCGGCGGGGGGGGGG + Intergenic
914156865 1:145094472-145094494 GAGCAGAGGCGGCGGGGTTCAGG + Intronic
914386157 1:147172225-147172247 GAGGCGCAGGGGCGGGGCCGGGG - Intronic
914803124 1:150974623-150974645 CGGCAGCGTTGGCGGGGCCGGGG + Exonic
915208445 1:154287841-154287863 CAGTAGGGGCGGCGGGGCAGAGG - Intergenic
915410859 1:155700620-155700642 CAGTAGGGGCGGCCGGGCCGAGG - Intronic
915489167 1:156241995-156242017 GAGCTGCGGCTGCTGGGCCAGGG - Exonic
915934782 1:160084067-160084089 GAGGAGCCGCCGCGGCGCCGCGG + Exonic
916050011 1:161029564-161029586 CAGAAGGGGCGGCGGGGCAGAGG - Intronic
916694396 1:167221314-167221336 GCGGCGGGGCGGCGGGGCCGGGG + Intronic
916890255 1:169106612-169106634 CGGCGGCGGCGGCGGGGCGGGGG - Exonic
917291616 1:173477260-173477282 GGGCGGCGGGGGCGGGGCCGCGG - Exonic
917553274 1:176057934-176057956 CAGAAGGGGCGGCGGGGCAGAGG - Intronic
918114027 1:181482202-181482224 GAGGAGCGGCGACGCGGCCATGG + Intronic
919724584 1:200873514-200873536 GTGCTGCGGCGTCTGGGCCGTGG + Exonic
919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG + Exonic
919892005 1:201982583-201982605 GCGCGGCGGGGGCGGGCCCGCGG + Intronic
920451735 1:206064706-206064728 CAGCAGGGGCGGCCGGGCAGAGG - Intronic
920468061 1:206204379-206204401 GAGCAGAGGCGGCGGGGTTCAGG - Intronic
920528483 1:206685276-206685298 GGGCTGCGGCGGCGGGGCCGGGG - Exonic
921029788 1:211327038-211327060 GCGAGGCGGCGGCTGGGCCGGGG + Intronic
921039535 1:211416660-211416682 AGGCAGCAGCGGCGGCGCCGGGG + Intergenic
921044106 1:211460915-211460937 CAGCAGGGGCGGCCGGGCAGAGG - Intergenic
921217736 1:212951476-212951498 CGGCAGCGGCGGCGGCGGCGGGG - Exonic
921269257 1:213452666-213452688 GTGCTGCGGAGGCGGGGCAGTGG - Intergenic
922496657 1:226062735-226062757 GAGCGACGGCGGCGCGGCGGCGG - Intronic
922648637 1:227318191-227318213 CAGCAGCTGCGGCGGCGGCGCGG + Exonic
922693028 1:227710694-227710716 CAGTAGGGGCGGCGGGGCAGAGG + Intergenic
922730728 1:227947738-227947760 GGGCGGGGGCGGCGGGGCCGGGG - Intronic
922796103 1:228340636-228340658 GGGCAGAGGAGGCGGGGCAGGGG - Intronic
922937311 1:229432493-229432515 TAGCGGCGGGGGCGGGGGCGGGG + Intronic
922950972 1:229558427-229558449 GAGGAGCGGCTGCCGGGGCGGGG - Exonic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
923126789 1:231040322-231040344 GAGGAGAGGGGGCGGGGCCGGGG - Intergenic
923372332 1:233327322-233327344 GAGCACCTGCGGCGGGGGCGGGG + Intergenic
923506300 1:234609237-234609259 GAGCGGCGGCGGCTTGGCGGCGG + Exonic
923744308 1:236686417-236686439 GGGCGGTGGCGGCGGGGGCGTGG + Intergenic
924436699 1:244048952-244048974 ACGCGGCGGCGGCGGGGACGCGG + Intronic
1062920420 10:1274921-1274943 GAGCAGCTGCGGCCGGGACACGG + Intronic
1063452962 10:6163695-6163717 GACCGGCGGGGGCGGGGCCTGGG + Intronic
1064060085 10:12129797-12129819 GAGTAGCGGCGGCTGGAGCGGGG + Intronic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064244270 10:13656918-13656940 GCGCGGCGGCGGCGGCGACGAGG - Exonic
1065188870 10:23192958-23192980 GAGCGGCGGCTGCGGCGGCGCGG + Exonic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066094075 10:32056206-32056228 CGGCAGCGGCGGCGGCACCGGGG + Exonic
1066180727 10:32958336-32958358 GCGCAGAGGAGGCGGGGCCGCGG - Intronic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1066441286 10:35441491-35441513 GCGCAGTGGCTGCGAGGCCGAGG + Intronic
1066464512 10:35640817-35640839 GGGCGGTGGCGGCGGGGACGCGG - Exonic
1066963970 10:42243674-42243696 TGGCAGCGGCGGCGGGGGGGGGG - Intergenic
1067478092 10:46579236-46579258 CAGCGGGGGCGGCGGGGCGGAGG - Intronic
1067616648 10:47762551-47762573 CAGCGGGGGCGGCGGGGCGGAGG + Intergenic
1069386174 10:67884927-67884949 GTGCGGCGGCGGCGGCGCTGTGG + Exonic
1069424686 10:68279045-68279067 CAGCAGCGGCGGCGGGGGAGGGG + Intergenic
1069438296 10:68406546-68406568 GCGCAGCCGGGGCGTGGCCGCGG - Intronic
1069544542 10:69319017-69319039 GACCAGCGGCGGCGCGGGCGGGG - Intronic
1069698350 10:70404342-70404364 AGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1070151986 10:73811079-73811101 GAGCAGCGGCGCGGAGGCTGCGG + Intronic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070476751 10:76836424-76836446 GAGCAGGGGCTGCAGGGCAGTGG + Intergenic
1070610164 10:77927084-77927106 GGCCGGCGGCGGCGGGGCTGTGG - Intergenic
1070768350 10:79069023-79069045 GAGCGGCGGCGGCGGGCGCCGGG + Exonic
1071086778 10:81875118-81875140 GAGGAGCGGGGGAGGGGACGGGG - Intergenic
1071966590 10:90858102-90858124 AGGCGGCGGCGGCGGGGACGCGG - Intergenic
1073122655 10:101131892-101131914 CGGCAGCAGCGGCGGTGCCGGGG + Exonic
1073269003 10:102245727-102245749 GAGCAGCGGCTGCCGGTCCTGGG + Exonic
1074592098 10:114822375-114822397 GAGCCGGGGCGGGGGTGCCGGGG + Intronic
1074772328 10:116742262-116742284 GGTCAGCAGCAGCGGGGCCGGGG - Intronic
1074829912 10:117241093-117241115 GAGCGGCGGCGGCGGGGCGCTGG + Exonic
1075031904 10:119029643-119029665 GGGCCGCGGCGGCGAGGCCGGGG + Intergenic
1075119058 10:119651311-119651333 GAGGAGCGGGGGCGGGGCCTCGG - Intergenic
1075375514 10:121975132-121975154 CAGCAGCGGCCGCGGGCCAGAGG - Exonic
1075430159 10:122373901-122373923 CAGTAGCGGTGGCGGGGACGGGG - Intergenic
1076116961 10:127907443-127907465 CCGCGGGGGCGGCGGGGCCGGGG - Intronic
1076306202 10:129467189-129467211 GGGGCGCGGGGGCGGGGCCGAGG - Exonic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076683419 10:132186587-132186609 GGGCAGCGGGGGCGCGGGCGGGG + Intergenic
1076722097 10:132397182-132397204 CGGCGGCGGCGGCGGGGCGGGGG + Exonic
1076750031 10:132537876-132537898 GAGCGACGGGCGCGGGGCCGCGG + Exonic
1076792824 10:132785985-132786007 GGGCAGGGGCGGCGGCGGCGGGG - Exonic
1076815278 10:132911496-132911518 GAGCACCCGCGGTGGGGCGGGGG - Intronic
1076849407 10:133085815-133085837 GAGCAGCGGGGGAGGGGCCCTGG + Intronic
1076878682 10:133229848-133229870 GGGCGGGGGCGGCGGGGGCGGGG + Intergenic
1076985981 11:236376-236398 GGGAGGCGGAGGCGGGGCCGGGG - Exonic
1077208895 11:1359083-1359105 CAGAGGCGGCGGCGGGGCTGGGG - Intergenic
1077385591 11:2268168-2268190 GAGCACCGGCTGTGGGGCTGAGG - Intergenic
1077922968 11:6655473-6655495 CGGCAGCGGCGGCGGAGCCGGGG - Intronic
1078098283 11:8313595-8313617 GAGCAGCTGCAGGGGAGCCGCGG + Intergenic
1078210383 11:9265289-9265311 CTGCAGCGGCGGCGGCGCGGAGG - Exonic
1078514272 11:12009143-12009165 GAGGGGCGGCGGCGGGGGAGGGG - Intronic
1078987055 11:16607059-16607081 GAGCCGCGGCTGCCGGGCCGGGG - Intronic
1079362002 11:19777280-19777302 CAGCAGCGGCCCCGGGGCGGGGG + Intronic
1081289213 11:41305154-41305176 CAGTAGGGGCGGCGGGGCAGAGG - Intronic
1082025111 11:47565821-47565843 GAGCGGCGGGGACGGGGCAGGGG - Intronic
1082787507 11:57324889-57324911 TAGCAGCGGCGGCGGCGGCGGGG - Intronic
1082814584 11:57499671-57499693 GAGCAGCGGCCCAGGGGGCGGGG + Intronic
1082816966 11:57515419-57515441 GAGCAGCGTGGGCGGGGAGGGGG - Intronic
1083256407 11:61498775-61498797 GAGCAGCGGTGGGGAGGCCTGGG - Intergenic
1083304810 11:61756675-61756697 GAACAGAGGCGGCGGGGGTGGGG + Intronic
1083431503 11:62615726-62615748 CAGCTGCAGCGGCAGGGCCGGGG - Exonic
1083753871 11:64778575-64778597 GGCCGGGGGCGGCGGGGCCGGGG + Intronic
1083766461 11:64843754-64843776 GGGCTGTGGCGCCGGGGCCGGGG - Intronic
1083856794 11:65396937-65396959 CAGCAGCGACGGCGGGTGCGAGG + Exonic
1083895211 11:65616293-65616315 GGGCAGCAGCGGCGGGGCCATGG + Exonic
1083970301 11:66070400-66070422 CGGCGGCGGCGGCGGGGGCGCGG - Intronic
1084086580 11:66857743-66857765 CAGCAGGAGCGGCGGGGCCATGG - Exonic
1084087178 11:66860019-66860041 GAGCAGCTGCGCTGCGGCCGGGG - Exonic
1084148557 11:67277636-67277658 GAGCAGCTGCGGCCGCGCCAAGG - Intronic
1084285487 11:68128260-68128282 GATGAGCGGCGGCGGGGAGGAGG + Intergenic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1086064566 11:82732566-82732588 GGGCGGCGGCGGCGGGGGCAGGG + Exonic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1087057039 11:93946652-93946674 CAGTAGGGGCGGCGGGGCAGAGG + Intergenic
1088522268 11:110712474-110712496 GAGCGGAGGGGGCGGGCCCGAGG - Intronic
1089499913 11:118925799-118925821 GTGCAGCGGCCCCGGGTCCGGGG + Intronic
1089520041 11:119057243-119057265 GCGCCGGGGCGGCGGGGGCGGGG - Intergenic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090293888 11:125569551-125569573 GAGCCGCGGCGGCGGAGCTGTGG + Exonic
1091226049 11:133956939-133956961 GTGCCGCTGCGCCGGGGCCGGGG - Exonic
1091381913 12:67246-67268 GAGCAGCCCCAGCGGGGCCCTGG + Exonic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091581589 12:1793703-1793725 GAGTAGGGGCGGCGAGGCTGAGG + Exonic
1091740939 12:2959866-2959888 GCGCAGTGAAGGCGGGGCCGCGG - Intronic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1091968203 12:4763626-4763648 GAGAAACGGGGGCGGGGCGGGGG - Intronic
1092196998 12:6555671-6555693 AAGCAGGGCCGGCGGGGCCTGGG - Exonic
1092197796 12:6560404-6560426 GAGCAGGGGAGGCTGGGCTGGGG - Intronic
1092462493 12:8698391-8698413 GATTAGCGGGGGCTGGGCCGGGG + Intronic
1092743167 12:11649555-11649577 GAGGGGCGGCCGCGGGGGCGCGG - Intergenic
1092860817 12:12717632-12717654 GAGACTCGGCGGCCGGGCCGGGG + Exonic
1093465022 12:19440029-19440051 CAGCAGCAGCGGCGGGGGTGAGG + Exonic
1094040232 12:26114357-26114379 GAGCCGAGGCGGCCGGGCCCGGG - Intergenic
1094588673 12:31800980-31801002 GTGGAGGGGCGGCGGGGGCGGGG + Intergenic
1094840366 12:34340287-34340309 GAGCGGCGTTGGCGGGGCCAGGG - Intergenic
1096064037 12:48724995-48725017 CAGCAGGGGCGGCCGGGCAGAGG - Intergenic
1096533847 12:52258459-52258481 ATGCAGCAGCGGCCGGGCCGGGG + Intronic
1096538754 12:52291386-52291408 ATGCAGCAGCGGCCGGGCCGCGG + Exonic
1096540021 12:52301974-52301996 ATGCAGCAGCGGCCGGGCCGGGG - Exonic
1096627370 12:52903962-52903984 CGGCAGCGTGGGCGGGGCCGAGG - Intronic
1096692271 12:53328575-53328597 GAGCAGCAGCGGCTGGGCTGCGG - Exonic
1096773846 12:53952424-53952446 GAGCAGCGGCCACAGGGCGGCGG - Intergenic
1096786852 12:54021766-54021788 CAGGAGCGGCTGCGGCGCCGTGG - Intronic
1097192314 12:57225407-57225429 CAGCAGCAGCGGCGGGGCCCGGG + Exonic
1097232383 12:57520651-57520673 GAGCGACGGGGGCGGTGCCGCGG - Intergenic
1097891408 12:64780945-64780967 GGGGAGCGGCGGAGCGGCCGCGG + Intergenic
1097891447 12:64781105-64781127 GGGCGGGGGCCGCGGGGCCGAGG + Intergenic
1097990258 12:65825587-65825609 GAGCCGCGGCGGGCGGCCCGGGG + Intronic
1098320710 12:69240146-69240168 GAGCGGCAGCGGCGGGGAAGGGG - Intronic
1098550375 12:71755144-71755166 CGGCGGCGGCGGCGGGGCGGCGG + Exonic
1100570353 12:95840657-95840679 CAGTAGGGGCGGCCGGGCCGAGG + Intergenic
1100844396 12:98644581-98644603 GAGCAGCGGAGGCGGGGGCTGGG - Exonic
1101371842 12:104137926-104137948 GGGGAGCGGGCGCGGGGCCGCGG - Intronic
1101970718 12:109310079-109310101 GGGCAGCGGCGGCGCGGGCCGGG - Intergenic
1102256492 12:111418466-111418488 GGCCAGGGGCGGCGGGGCCGGGG - Exonic
1102371015 12:112382318-112382340 CGGCGGCGGCGGCAGGGCCGGGG - Intronic
1102487154 12:113266283-113266305 CAGCAGCAGCAGCAGGGCCGTGG - Exonic
1102997540 12:117361511-117361533 GAGCAGCGGCCGAGCGGACGGGG - Exonic
1103299807 12:119918720-119918742 CAGTAGGGGCGGCCGGGCCGAGG + Intergenic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1103908678 12:124340172-124340194 GAGCAGCGGCAGCAGCGGCGGGG - Exonic
1103909084 12:124342066-124342088 AGGCAGCGGCTGCGGGGCAGAGG + Exonic
1103935591 12:124474882-124474904 GTGCAGCTGCTGCGGGGGCGGGG - Intronic
1104021265 12:124993884-124993906 GCGCAGGGGGCGCGGGGCCGCGG + Exonic
1104049652 12:125186807-125186829 GAGCGGCGGCGCCCGGCCCGGGG - Intergenic
1104376223 12:128267232-128267254 GAGCTGCGGCGGCGTGGACCCGG + Intergenic
1104428271 12:128695858-128695880 GAGGAGGAGCGGCGGGGCCGGGG + Exonic
1104841458 12:131828041-131828063 GCGCTGCGGCGGCGGCTCCGGGG + Intergenic
1104857777 12:131909933-131909955 CAGCTGCCGCAGCGGGGCCGAGG - Exonic
1104902474 12:132196965-132196987 CAGCAGAGGCTGAGGGGCCGGGG - Exonic
1105004167 12:132710821-132710843 GCGGAGCGCCGTCGGGGCCGTGG + Exonic
1105022817 12:132828695-132828717 GAGGGGCGGCGGCGGGGCCTGGG - Exonic
1105217489 13:18297632-18297654 GGGCAGCGGCGGCGGCGGCTAGG + Intergenic
1105413834 13:20192792-20192814 GAGGAAGCGCGGCGGGGCCGGGG + Intronic
1105514307 13:21076430-21076452 GTGCAGGGGCGGAGGGGCGGTGG + Intergenic
1105745621 13:23375126-23375148 GAGCAGCGGCTGTGGCGCGGCGG - Exonic
1106340263 13:28820310-28820332 GCGCAGCCGCGGCGCGGGCGTGG + Intergenic
1106602496 13:31199985-31200007 CAGCCGCGGCGGCAGGGCGGCGG + Exonic
1107437374 13:40391976-40391998 GTGCAGCTGCTCCGGGGCCGTGG - Intergenic
1107468173 13:40667266-40667288 GAGCCGCGGCGCCGGGGGTGGGG - Intergenic
1107548894 13:41457487-41457509 CCGGAGCGGAGGCGGGGCCGGGG - Intergenic
1107603920 13:42040491-42040513 GAGGAGGGGCGGCGGGGGGGAGG + Intronic
1107604034 13:42040820-42040842 CAGCGGCGGCGGCGGGGACCCGG + Intronic
1108086367 13:46797268-46797290 GTGCAAAGGCGGCGGGGCCATGG - Intergenic
1108227465 13:48303971-48303993 GGGCGGCGGCGGCGGTGCCGGGG - Exonic
1108370448 13:49762295-49762317 CAGCAGGGGCGGCTGGGCAGAGG - Intronic
1110180412 13:72610667-72610689 CAGCAGCGGCAGCGAGGCTGGGG + Intergenic
1110275847 13:73640934-73640956 CAGCAGCGGCAGCGAGGCTGGGG + Intergenic
1110328173 13:74241536-74241558 CAGCAGCGGCAGCGAGGCTGGGG - Intergenic
1111672464 13:91348064-91348086 TGGCGGCGGCGGCGTGGCCGGGG + Intergenic
1112294779 13:98177080-98177102 GAGCAGCAGCAGCGGGGACGAGG - Exonic
1112504971 13:99970092-99970114 CGGCGGCGGCGGCGCGGCCGGGG + Intronic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1112733692 13:102394694-102394716 GGGCAGCGGCGGCGGGACCGGGG + Intronic
1113201067 13:107867600-107867622 GGCGGGCGGCGGCGGGGCCGCGG + Intergenic
1113377897 13:109782132-109782154 CAGCACCGGCGGCGGGTGCGGGG - Exonic
1113794765 13:113050708-113050730 GAGCAGGGGGGGCGGGGGCGGGG + Intronic
1113820194 13:113208428-113208450 GAACAGCGGCGGCCGGGACTCGG - Intronic
1113820276 13:113208728-113208750 GCGCACCCGCGGCGGGGCCGGGG - Intronic
1114253070 14:20978130-20978152 GAGTAGCAGCAGCTGGGCCGGGG - Intergenic
1114318322 14:21526272-21526294 GAGCAGCGGCGGAGGGGGAGGGG + Intronic
1114483295 14:23048216-23048238 GCGCCACGTCGGCGGGGCCGGGG + Exonic
1115028230 14:28766819-28766841 GAGCGGCCGCGGCGAGGCTGGGG - Intergenic
1115398238 14:32933294-32933316 GGGCTGGGGCGGCGCGGCCGCGG + Intergenic
1115651240 14:35404198-35404220 GAGGGGCGGCGGCTGGGCCCTGG - Intronic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1116452848 14:45083998-45084020 GGGCTGCGGGGGCGGGGCTGGGG + Intergenic
1116895669 14:50312614-50312636 GCGGGGCGGGGGCGGGGCCGAGG - Intronic
1117388537 14:55240967-55240989 GGATAGCCGCGGCGGGGCCGGGG + Intergenic
1117690414 14:58299386-58299408 GAGCGGCGGAGGCGGGGCGCGGG + Intronic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1118350999 14:64972366-64972388 GGGCGGCGGCGGCGGCGCAGGGG - Intronic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1119519700 14:75277102-75277124 GAGCGGCCGCGGCCGGGCCGGGG + Intergenic
1119759656 14:77141544-77141566 GTGCGGCGGCGGCGGCGCGGGGG - Intronic
1120200556 14:81533813-81533835 GAGCAGCGGCGAGGCGGCGGTGG - Exonic
1120976579 14:90254218-90254240 GGACAGAGGGGGCGGGGCCGGGG - Intergenic
1121074973 14:91060398-91060420 TGGCAGCAGCGGCGGCGCCGCGG - Exonic
1121127544 14:91417773-91417795 GAGCAGCGGGCGCGGGGCTGCGG + Exonic
1121473443 14:94174238-94174260 GGGCTGCGGGGGCGGGGCCAGGG - Intronic
1122066297 14:99176233-99176255 GAGAAGCGGCAGCGGGGCGCGGG + Intronic
1122162301 14:99793310-99793332 CGGCGGCGGCGGCGGGCCCGGGG + Intronic
1122541674 14:102501180-102501202 GAGCGGCGGGGGCGGGGCATGGG + Exonic
1122568405 14:102677093-102677115 CAGTAGGGGCGGCCGGGCCGAGG + Intronic
1122581986 14:102777133-102777155 GACGCGCGGCGGCGGGGGCGCGG + Intergenic
1122582080 14:102777386-102777408 GGGCGGCGGGGGCGGGGCGGCGG + Intergenic
1122620714 14:103056560-103056582 GAGGTGCGGGGGCGGGGGCGGGG + Intronic
1122635378 14:103127269-103127291 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1122695802 14:103551490-103551512 GAGCTGCTGCGGCAGGGCTGGGG - Intergenic
1122779157 14:104136372-104136394 GCGCGGCGGCGGCGGGCGCGCGG + Intergenic
1122866118 14:104604757-104604779 GAGCGGCGGCGGGAAGGCCGCGG + Exonic
1122959422 14:105087664-105087686 GAGCAGCGGCGGGGCGGGCGGGG + Intergenic
1123001926 14:105300473-105300495 GAGCAGCGGCGGCGGCTCCTCGG - Exonic
1123024040 14:105415227-105415249 GAGCCGCGCGGGCGGGGGCGCGG + Intronic
1123108960 14:105856388-105856410 TATCAGGGGTGGCGGGGCCGTGG + Intergenic
1123423254 15:20148292-20148314 GGACAGCGGCGGCGCGGCGGAGG + Intergenic
1124129492 15:26971534-26971556 GAGCAGCAGCTTCGGGGCCATGG - Exonic
1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG + Exonic
1125516486 15:40323924-40323946 GAGGAGCGGCGGCGGAGCGCGGG + Intergenic
1125684982 15:41558851-41558873 GCGGGGCGCCGGCGGGGCCGCGG + Intronic
1125719548 15:41838782-41838804 GAGCAGAGGCGGCGGGTAGGAGG + Exonic
1125742010 15:41972098-41972120 GGCCAGCCGGGGCGGGGCCGAGG + Intronic
1125862970 15:43015072-43015094 CAGTAGGGGCGGCCGGGCCGAGG - Intronic
1127458798 15:59179133-59179155 GAGCAGGGGCAGAGGCGCCGAGG - Intronic
1127606511 15:60592478-60592500 GGGCGGCGGCGGCGCGGCGGCGG - Intronic
1127995589 15:64151753-64151775 GAGCAGCTGGGGCCGGGGCGCGG + Exonic
1128322667 15:66703914-66703936 GAGCAGCAGCTGCGGCGGCGCGG - Exonic
1129052884 15:72797181-72797203 GTACAGCCGCGGCTGGGCCGAGG - Intergenic
1129116414 15:73367767-73367789 GGGCGGCGGCGGCGAGGCTGCGG + Exonic
1129116778 15:73368990-73369012 GGGCAGCGGCGCACGGGCCGGGG + Exonic
1129440720 15:75579180-75579202 GAGGAGCGGGAGCGCGGCCGAGG - Exonic
1129742122 15:77994367-77994389 GAGCGGCGGCGGCAGAGCTGGGG - Intronic
1129752822 15:78077691-78077713 GCGCAGCGGCCGCGGCGCGGAGG - Intronic
1130348052 15:83067065-83067087 GGGCGGCGGCGGCGGCCCCGCGG + Exonic
1130370594 15:83283414-83283436 GGGCGGCGGCGGCGAGGCTGGGG - Intronic
1130370983 15:83284878-83284900 GCGCAGCTGAGGCGAGGCCGTGG + Intergenic
1131051719 15:89352603-89352625 GAGCAGAGGCCGTGGGGCAGTGG - Intergenic
1131053493 15:89362652-89362674 GATCAGGGGTGGCGGAGCCGCGG + Intergenic
1132055558 15:98648545-98648567 TGGCAGCGGCGGCGGCGGCGCGG + Intergenic
1132383122 15:101380341-101380363 GAGCGGAGGCGCCGGGGCAGAGG + Intronic
1132512841 16:352719-352741 GAAGTGCGGGGGCGGGGCCGGGG + Intergenic
1132553496 16:563130-563152 GGGCAGAGGCGGCGGGGTGGGGG + Intronic
1132589959 16:722268-722290 GAGTAGAGGGGGCGGGGGCGGGG - Intronic
1132605646 16:792693-792715 GAGGAGAGGCGGCAGGGCCAGGG - Intronic
1132815910 16:1826523-1826545 GCGGAGCGGGCGCGGGGCCGCGG - Intronic
1133040884 16:3059247-3059269 GCGCAGGGGCGGCGGCGGCGGGG + Exonic
1133079162 16:3305145-3305167 GAGCACGGCCGGCCGGGCCGCGG + Intronic
1133350622 16:5098228-5098250 GAGCTCAGGAGGCGGGGCCGGGG + Intergenic
1133784294 16:8963172-8963194 GGCCGGCCGCGGCGGGGCCGGGG - Intronic
1133784439 16:8963614-8963636 GGGCCGGGGCTGCGGGGCCGCGG + Intronic
1134149875 16:11797195-11797217 CGGCGGCGGCGGCGGGGCCTGGG + Intronic
1134419324 16:14071340-14071362 GAGCGGCGGCGGCGGCGGCCGGG + Intronic
1134665238 16:16013914-16013936 GAGCAGGGGCGATGGGGCAGAGG + Intronic
1134781027 16:16895710-16895732 GTGGAATGGCGGCGGGGCCGGGG - Intergenic
1135821772 16:25692057-25692079 CAGAAGCCGCGGCGGAGCCGGGG + Exonic
1135822009 16:25692804-25692826 GAGCGGCGGCGGAGGCGCCCAGG + Exonic
1135976119 16:27109855-27109877 CAGAGGCGGCGGCGGGACCGGGG + Intergenic
1136237835 16:28925350-28925372 GAAGAGCCGGGGCGGGGCCGGGG - Exonic
1136364874 16:29805403-29805425 GGGCTGCGGGGGCGGGACCGGGG + Intergenic
1136453962 16:30370109-30370131 GGGCGGCGGCGAGGGGGCCGCGG + Exonic
1136572362 16:31104986-31105008 CAGTAGGGGCGGCGGGGCAGAGG - Intergenic
1136668680 16:31836827-31836849 CAGCAGGGGCGGCCGGGCAGAGG - Intergenic
1136768591 16:32812004-32812026 AAGCCGCGGCGGCGGGGGGGGGG + Intergenic
1137988671 16:53131124-53131146 GAGCAGCGGCCGCTGCCCCGCGG - Intronic
1138400490 16:56740010-56740032 CAGTAGGGGCGGCGGGGCAGAGG + Intronic
1139469449 16:67170487-67170509 CAGCAGCTGCGGCGGGGGCGGGG - Intronic
1139528097 16:67528779-67528801 GGGGAGGGGCGGCGGGGCGGCGG + Intronic
1139546627 16:67652855-67652877 CAGCGGCGGCGGCGGGGGAGGGG + Intronic
1140440637 16:74985020-74985042 GGGCCGCGGCGGCCGGGCGGGGG - Exonic
1140474067 16:75229889-75229911 GAGCAGCAGCTGCCGGTCCGAGG + Exonic
1140476949 16:75243872-75243894 GGGCAGCAGCGGCAGGGGCGAGG - Intronic
1140994482 16:80244238-80244260 CAGCAGGGGCGGCCGGGCAGAGG - Intergenic
1141086078 16:81096380-81096402 GAGGCGCGGAGGCGGTGCCGCGG + Exonic
1141461466 16:84180783-84180805 GAGCAGGGGAGGAGGGGCCTCGG - Intronic
1141482009 16:84313084-84313106 TAGCAGCAGCGCCGGTGCCGCGG - Exonic
1141608577 16:85169243-85169265 CGGCGGCGGCGGCGGGGCCCGGG - Intergenic
1142172966 16:88632399-88632421 GAGCAGCAGCGGTGGGTCCTGGG - Intergenic
1142276512 16:89121750-89121772 GTGCAGAGGCTGAGGGGCCGTGG + Intronic
1142285918 16:89171510-89171532 GGGCAGGCGGGGCGGGGCCGGGG - Intergenic
1142312402 16:89321487-89321509 GAGCCGCAGCTGCGGGGCAGGGG + Intronic
1142376748 16:89710651-89710673 GAGCGGCAGGGCCGGGGCCGTGG - Exonic
1142395346 16:89828562-89828584 GGGCAGCTGCGGCGGCGCCGCGG + Exonic
1142417206 16:89949181-89949203 GAGCAGCGGCGGCGTCCCCGGGG - Intronic
1142427933 16:90010747-90010769 GAGCAGCTGAGGAGGGGCTGAGG - Intronic
1203070913 16_KI270728v1_random:1073770-1073792 AAGCAGCGGCGGTGGCGGCGGGG + Intergenic
1203071017 16_KI270728v1_random:1074139-1074161 AAGCCGCGGCGGCGGGGGGGGGG + Intergenic
1142586869 17:979472-979494 GGGACGCGGCGGCCGGGCCGGGG - Exonic
1142709618 17:1716006-1716028 GAGAAGGGGCGGCGGGGGCAGGG - Intergenic
1142752795 17:1998505-1998527 GGGCAGCGGTGGCCGGCCCGGGG - Intronic
1142836812 17:2593659-2593681 GAGCTGGAGCGGCGGGGCGGCGG + Intronic
1142848134 17:2691935-2691957 GCGGGGCGGGGGCGGGGCCGCGG - Intronic
1142876400 17:2853939-2853961 GAGCCGGGGCTGCGGGGACGCGG + Intronic
1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG + Exonic
1143063341 17:4222164-4222186 TAGCAGCAGCGGCGGCGGCGGGG - Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143503516 17:7351939-7351961 GAGCGGCGGCGGGGCGGTCGTGG + Intronic
1143509956 17:7389974-7389996 AGGCAGCGGCGGGGGGGCGGTGG + Exonic
1143830300 17:9645678-9645700 GAGCGGCGGCGGCGGGGCCGGGG - Exonic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1144109998 17:12021459-12021481 CCACTGCGGCGGCGGGGCCGAGG - Intronic
1144840771 17:18184225-18184247 GAGCAGCGTCGTGGGGGCCATGG + Exonic
1144949396 17:18985787-18985809 GAGCAGGGCAGGCGGGGCCAGGG + Intronic
1144953033 17:19004220-19004242 GGGGAGGGGCGGCGGGGGCGGGG + Intronic
1145305751 17:21674258-21674280 GAGCGGCGGCTGCGGGGACTGGG + Intergenic
1145370900 17:22305224-22305246 GAGCGGCGGCTGCGGGGACTGGG - Intergenic
1145684617 17:26639276-26639298 CAGTAGGGGCGGCGGGGCAGAGG - Intergenic
1146142337 17:30378939-30378961 GAGCCGCGGGAGCGGAGCCGGGG + Exonic
1146155945 17:30523632-30523654 GGGCAGGGGCGGCCGGGCAGAGG - Exonic
1146322658 17:31859008-31859030 GGGCGGGGGCCGCGGGGCCGGGG - Intronic
1146339604 17:32007668-32007690 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1146393641 17:32444636-32444658 GAGCTGGGCCGGCGGGGCCGGGG - Intronic
1146398591 17:32487095-32487117 GGACCGCGGCGGCGGGGCCGCGG + Exonic
1146943538 17:36859726-36859748 GAGCAGGGGGGTCGGGGTCGGGG + Intergenic
1147139716 17:38454145-38454167 GAGCCGCGGGGCCGGGGCCGGGG + Intronic
1147220970 17:38930571-38930593 CAGCAGGGGCGGCCGGGCAGAGG + Intergenic
1147375214 17:40018958-40018980 GAGCAGAGGCGGCAGGGCTCAGG - Intergenic
1147425001 17:40342142-40342164 GAGCTGGGGTGGGGGGGCCGTGG + Intronic
1147743074 17:42679620-42679642 GGGCAGCCGCGGCGGGGTTGAGG + Exonic
1147752450 17:42744739-42744761 GAGCGGCGGGGGCGGGCTCGGGG - Intronic
1147792494 17:43022179-43022201 CAGCAGTGGCGGCGAGGCGGCGG + Exonic
1147793082 17:43025287-43025309 GGGAGGCGGCGGCGGGGCCCGGG + Exonic
1148126934 17:45241982-45242004 GGGCAGCGGCGGCGCAGGCGGGG - Exonic
1148178080 17:45584879-45584901 GGGCAGCGGCAGCGGCGGCGGGG + Intergenic
1148178083 17:45584885-45584907 CGGCAGCGGCGGCGGGGCCGGGG + Intergenic
1148323786 17:46771927-46771949 GAGGCGCGGCGGCGGCGCGGCGG - Intronic
1148556596 17:48582227-48582249 GCGCACCGGCGGCGGCGGCGCGG + Intronic
1148805075 17:50259840-50259862 AAGCAGCGGCAGCAGGGCTGGGG + Intergenic
1148836569 17:50468844-50468866 CAGCAGCGGCGGCGGGGCGCGGG + Exonic
1149296276 17:55265034-55265056 GAGCAGCGGCCGCCGGCGCGGGG + Exonic
1149512734 17:57256574-57256596 GAGCGGCGGAGCCGGGGCAGCGG - Exonic
1149599707 17:57885522-57885544 GAGCAGCAGCGGCAGCGGCGGGG - Exonic
1149614754 17:57988310-57988332 GGGCGGCGGCGGCCGGGCCGGGG - Intergenic
1149648119 17:58255086-58255108 GAGAAGCAGCAGAGGGGCCGGGG - Intronic
1149685377 17:58531855-58531877 CAGCCGCGGCTGCGGTGCCGCGG + Intronic
1150239982 17:63623023-63623045 GGGAAGCGGCGGCGGGACCGAGG + Intronic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1150407979 17:64919175-64919197 CGGCGGCGGCGGCGGGGCCGGGG + Intronic
1150488877 17:65561268-65561290 GCGGAGCGGTGGCGGGGCTGCGG - Intronic
1150747241 17:67825786-67825808 CGGCGGTGGCGGCGGGGCCGGGG - Exonic
1150764625 17:67993545-67993567 GCGCGGCGGCGGCGCGGGCGCGG + Intronic
1150791890 17:68205754-68205776 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1151155308 17:72120204-72120226 GAGGAGCGTCGGCAGGGTCGCGG + Intergenic
1151318442 17:73338142-73338164 GAGCAGCGGCAGTGGGTCCAGGG + Exonic
1151477825 17:74353845-74353867 GAGCGGAGGCGGCGGGGGAGGGG - Intronic
1151478543 17:74356878-74356900 CAGCAGCGGCGGCGACGCGGCGG - Exonic
1151492397 17:74440349-74440371 CAGCAGCGCAGGCTGGGCCGTGG + Exonic
1151611932 17:75182325-75182347 GGGCCGCGGCGGCGGGGCGAGGG - Intergenic
1151670683 17:75570258-75570280 GAGCAGGGGCGGCTGGGTCCCGG + Intronic
1151711412 17:75809081-75809103 GAGCGGCGGGGGCGGGGGCGGGG + Intronic
1151743653 17:76000598-76000620 GTGCAGCGCCGGCGGGGGCCAGG + Intronic
1151939031 17:77281370-77281392 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
1152096877 17:78277799-78277821 GAGCAGGGGCGGGGCAGCCGTGG - Intergenic
1152570841 17:81120643-81120665 GAGCAGCTGGGGCTGGGCCCAGG + Exonic
1152628616 17:81399681-81399703 GAGCAGCGCGGCCGGGGCCCGGG - Exonic
1152637410 17:81435780-81435802 GGGCTGCTGCGGCCGGGCCGGGG - Intronic
1152663176 17:81552360-81552382 GAGCCGCCGCCGCGCGGCCGGGG - Exonic
1152697499 17:81804316-81804338 GGGCGGGCGCGGCGGGGCCGGGG + Intronic
1152711226 17:81871259-81871281 GGGCGGAGGCGGCGGGGCGGAGG - Intronic
1152744273 17:82031860-82031882 GCGCAGCCGGGGCGGGGCGGGGG + Intronic
1152834406 17:82519945-82519967 GGCCGGGGGCGGCGGGGCCGGGG + Exonic
1152870672 17:82751667-82751689 GCGCAACGGGGGCGGGGCCCGGG - Intergenic
1152876319 17:82788389-82788411 GGGAGGCGGCGGCGGGGCTGGGG + Intronic
1153052190 18:909449-909471 GAGCCTCGGCGGCGGCGCGGGGG + Exonic
1153285384 18:3450967-3450989 GGGCGGCGGGGGCGGGGGCGGGG - Intronic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1154214870 18:12408307-12408329 GAGCGGGGGCGGCCGGGGCGGGG + Intronic
1154323492 18:13372860-13372882 GAGCAGAGGAGCAGGGGCCGAGG + Intronic
1155054384 18:22171362-22171384 GAGCAGCAGCGAGCGGGCCGGGG - Exonic
1155519850 18:26656922-26656944 GAGCCGCGGCGGAGCGGCCGCGG + Intronic
1156243036 18:35271861-35271883 CAGCAGCTGCGGAGGGGGCGCGG - Intronic
1156452664 18:37275338-37275360 GAGCCGGGGAGGCGGGGCGGGGG + Intronic
1157383818 18:47246661-47246683 CAGGGGCGGCGGCGGGGGCGGGG + Intronic
1157613788 18:48975514-48975536 GCACGGCGGCGGAGGGGCCGAGG + Intergenic
1157629301 18:49080271-49080293 CAGTAGGGGCGGCGGGGCAGAGG + Intronic
1158893573 18:61894253-61894275 GAGCGGCGGCCGCCGGCCCGGGG - Intergenic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1160024247 18:75205286-75205308 GAGCAGGGGCGGAAGGGCCAGGG + Intronic
1160224357 18:77000833-77000855 GATCAGCGGCTGCAGGGCCAAGG + Intronic
1160453040 18:78978803-78978825 GCGCGGCGACGACGGGGCCGGGG + Intergenic
1160706308 19:531787-531809 GGGCGGCGGCGGCGGCGCAGAGG + Exonic
1160738813 19:676612-676634 CGGCGGCGGCGGCGGGGGCGAGG + Intronic
1160862204 19:1242127-1242149 GGGCAGCAGAGGCAGGGCCGAGG - Intronic
1160871696 19:1280748-1280770 GGGCGGCGGCGGCTGGGCTGGGG - Intergenic
1160896940 19:1407554-1407576 GCGCAGGGGCGGCGGCGCGGCGG + Intronic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160975132 19:1789336-1789358 GGGTGGCGGCGGCGGGGCTGGGG - Intronic
1160990237 19:1857423-1857445 GGGCAGTGTGGGCGGGGCCGCGG + Intronic
1161210162 19:3061910-3061932 GAGCTGCGGCGGGGGGGCTCGGG + Intronic
1161302140 19:3547884-3547906 GAGCAGCAGGGGCTGGGCCGTGG + Exonic
1161394451 19:4037822-4037844 GGGCAGCGGCGCTTGGGCCGGGG - Exonic
1161450703 19:4343856-4343878 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1161461544 19:4400501-4400523 GAGCGGCTGAGGCGGCGCCGGGG - Exonic
1161607524 19:5223046-5223068 GAGCCGCGGCGGCCTGGGCGAGG - Exonic
1161718570 19:5891211-5891233 GACCCCCGGCGGCGGGGCCTGGG + Intronic
1161956509 19:7498872-7498894 GAGCAGAGGCGGAGGGTCAGGGG + Intronic
1161973243 19:7595708-7595730 GAGCAGCAGGGGCGGGGCGGAGG - Intergenic
1162021362 19:7869926-7869948 GGGCGGCGGCGGCGGGCCGGGGG + Exonic
1162079405 19:8209445-8209467 GAGGGCCGGCGGCGGGGCTGGGG - Exonic
1162079441 19:8209550-8209572 TGGCCGCGGAGGCGGGGCCGGGG - Intronic
1162094358 19:8301960-8301982 GAGCAGGGGCAGCAGGGCTGGGG - Intronic
1162470927 19:10871662-10871684 GCGCAGCGGCGGCGGCGGCGGGG + Exonic
1162535837 19:11262472-11262494 CGGCGGCGGCGGCGGGGCCGGGG - Intronic
1162572144 19:11480030-11480052 CAGCAGCGGCGGCGGGCCCGCGG + Intronic
1162929879 19:13952554-13952576 GAGCGGCGGCGGCGGCCCCGGGG + Exonic
1162954500 19:14090779-14090801 GTGCGGCGGCGGCGGCGGCGGGG - Intronic
1163154497 19:15432543-15432565 GGGCGGCGGCGGCGGCGCGGGGG + Intronic
1163282312 19:16325322-16325344 GGGCGGCGGCGGCGGCTCCGGGG - Exonic
1163364576 19:16868862-16868884 CAGCAGCGGAGGCGGGGGCTTGG + Intronic
1163442453 19:17328764-17328786 GGGCGGCGGCAGCGGGGGCGGGG - Exonic
1163478425 19:17540142-17540164 GAACAGCGGAGGAGGGGCGGGGG + Intronic
1163551178 19:17967169-17967191 GCCCGGGGGCGGCGGGGCCGGGG - Intronic
1163664141 19:18595189-18595211 CAGCAGGGGCGGCGGGGGCCGGG - Intronic
1163782504 19:19257858-19257880 GGGCGGCGGCGGCTGGGCAGGGG - Exonic
1164594520 19:29524952-29524974 GAGCTGAGGCGTAGGGGCCGGGG + Intergenic
1164595104 19:29527034-29527056 GGGAAGCGGCTGCAGGGCCGAGG - Intronic
1165057514 19:33187412-33187434 GGGCAGTGGCGGGGGGGCAGGGG - Intronic
1165328289 19:35126624-35126646 CAGCAGCCGCCGCGGGGCCAGGG + Exonic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165737123 19:38183807-38183829 GAGGTGCGGAGGCGGGGCCAGGG + Intronic
1165768246 19:38364029-38364051 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
1166294666 19:41883143-41883165 GGGGAGGGGCGGCGGGGCGGGGG + Intronic
1166809915 19:45508656-45508678 GAGCAAAGGGGGAGGGGCCGTGG - Intronic
1166888065 19:45973475-45973497 CGGCGGCGGCTGCGGGGCCGCGG + Exonic
1167149868 19:47702327-47702349 GTGCAGGGGCGGCGGGGATGCGG - Exonic
1167268232 19:48493819-48493841 GAGCAGCGCCGACGCGGACGCGG - Exonic
1167268251 19:48493883-48493905 CGGGCGCGGCGGCGGGGCCGCGG - Exonic
1167410136 19:49339529-49339551 GTGGAGCGGCGGGAGGGCCGGGG - Intronic
1167501618 19:49851530-49851552 GGGCTGGGGGGGCGGGGCCGTGG - Intronic
1167506389 19:49873179-49873201 GGGTGGTGGCGGCGGGGCCGCGG + Exonic
1167507344 19:49877915-49877937 GAGCCGGGGGGGCGGGGCCATGG - Exonic
1167596686 19:50432018-50432040 GAGCCGAGGGGGCGGGGCCTGGG - Intergenic
1167622693 19:50568133-50568155 CAGCGGCGGCGGTGGGGCTGGGG + Intergenic
1167622737 19:50568302-50568324 GAGCGGCGCCGGCGGGCCCGAGG - Intergenic
1167648919 19:50719352-50719374 CAGCTGCGGGGCCGGGGCCGCGG - Intronic
1167940565 19:52942712-52942734 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168339090 19:55613660-55613682 GAGCAGCGGCATCGGGGGCGAGG + Exonic
1168339476 19:55615051-55615073 GGGCGGGGGCTGCGGGGCCGAGG - Exonic
1202693295 1_KI270712v1_random:105832-105854 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
924987727 2:287605-287627 GCGCGGAGGCGGCGGGGCTGGGG - Exonic
925403450 2:3591016-3591038 CAGTAGGGGCGGCGGGGCAGAGG + Intergenic
925730566 2:6917429-6917451 GAGAAGCGGCTGCGCGGGCGGGG - Exonic
925929086 2:8693448-8693470 GAGCAGCCGCAGCGGGGCGGCGG + Intergenic
927472233 2:23385295-23385317 GCGCTGCGGAGCCGGGGCCGGGG - Exonic
927606563 2:24491495-24491517 GAGCCGCGGCGCCGGGCCCGAGG + Intergenic
927713863 2:25341040-25341062 CGGGAGGGGCGGCGGGGCCGGGG - Intronic
927755660 2:25705882-25705904 CAGAAGGGGCGGCCGGGCCGAGG - Intergenic
928518325 2:32064136-32064158 CGGCACCGGCGCCGGGGCCGAGG - Exonic
929064959 2:37963880-37963902 CAGCAGGGGCGGCGGGGCAGAGG + Intronic
929188605 2:39120455-39120477 GGGCGGCGGCGGCCGGGCCAGGG + Exonic
930704019 2:54486150-54486172 CAGCAGGGGCGGCCGGGCAGAGG - Intronic
930872604 2:56184109-56184131 GAGCAGCCGGGGAGGCGCCGCGG + Exonic
931252848 2:60549599-60549621 CAGCAGCGGCCGCGGGGCCTTGG + Intronic
931517832 2:63059941-63059963 GGGCAGCGGCGGCGGGAACGCGG + Intergenic
931681132 2:64750833-64750855 GAGCAGGGGCGGCCGCGGCGGGG + Intronic
931762513 2:65430972-65430994 GTGCGACGGGGGCGGGGCCGCGG - Intronic
932414650 2:71566216-71566238 GAGTGGCGGGGGCGGGGCGGGGG + Intronic
932567323 2:72918023-72918045 GGGCACTGGCGGCGGGGGCGCGG + Exonic
932716154 2:74101735-74101757 GAACATCGGCGGCGTGGCCGTGG + Exonic
932820707 2:74897501-74897523 GGGCGGCGGCGGCGGGGAGGGGG - Intergenic
933741736 2:85539231-85539253 GAGCAGCGGCGAGGCGGCAGCGG - Exonic
933776147 2:85772391-85772413 GGGCCGCGGCGGCCGGGCGGGGG - Intronic
933953273 2:87348727-87348749 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
933982807 2:87567275-87567297 GAGCTGGAGCGGCGGGGCAGTGG - Intergenic
934049673 2:88199784-88199806 GAGCAGCGGGGACAGGGCCTGGG - Intergenic
934079138 2:88452548-88452570 GGGCGGCTGCGGCGCGGCCGCGG + Exonic
934189042 2:89768018-89768040 AAGCCGCGGCGGCGGGGGAGGGG + Intergenic
934237504 2:90245072-90245094 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934467089 2:94273024-94273046 AAGCCGCGGCAGCGGGGGCGGGG + Intergenic
934467094 2:94273030-94273052 CGGCAGCGGGGGCGGGGGCGGGG + Intergenic
934527228 2:95059431-95059453 GAGCCTGGGAGGCGGGGCCGAGG - Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
934952222 2:98584510-98584532 GAGAAGCTGCGGCCAGGCCGAGG + Intronic
934954789 2:98608526-98608548 GGGCCGCGGCGGTAGGGCCGAGG + Intergenic
934970669 2:98761634-98761656 TGGCAGCGGCGGCGGGGTGGGGG - Intergenic
935011497 2:99140976-99140998 GAGTGGCGGGTGCGGGGCCGTGG - Intronic
935046750 2:99489876-99489898 CACTGGCGGCGGCGGGGCCGGGG - Exonic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936433263 2:112482229-112482251 GGGCGGCGGGGGCCGGGCCGCGG + Exonic
937301893 2:120847752-120847774 GGGCAGGGGCGGGGGGGCGGTGG + Intronic
937418609 2:121737027-121737049 GAGAAGCGGGGGCGGGGCACGGG + Intergenic
937951074 2:127388180-127388202 CAGGGGCGGGGGCGGGGCCGAGG - Intronic
939612934 2:144332295-144332317 CAGCAGCGGCGGCTGCGGCGCGG - Intronic
940971970 2:159904793-159904815 GGGCGGCGGGGGCGGGGCCGGGG - Intergenic
941476181 2:165953898-165953920 GAGCAGGGGCGGCGGGGACCCGG + Intergenic
941602989 2:167563600-167563622 CAGCAGGGGCGGCTGGGCAGAGG + Intergenic
941603036 2:167563719-167563741 CAGCAGCGGCGGCCGGGCAGAGG + Intergenic
941603087 2:167563842-167563864 CAGCAGGGGCGGCCGGGCAGAGG + Intergenic
942319035 2:174719808-174719830 GAGCGACGGCGGCGCGGCGGCGG - Intergenic
942890473 2:180980971-180980993 GAGGTAAGGCGGCGGGGCCGGGG + Exonic
945110394 2:206356388-206356410 CAGTAGGGGCGGCGGGGCAGAGG + Intergenic
945110566 2:206356787-206356809 CAGTAGGGGCGGCGGGGCAGAGG + Intergenic
945110642 2:206356962-206356984 CAGTAGGGGCGGCGGGGCAGAGG + Intergenic
946325289 2:218981771-218981793 CAGCGGTGGCGGCGGGGCCCGGG + Exonic
946692418 2:222319502-222319524 GGGCGGCGGTGGCGGGGCCGGGG + Intergenic
946921427 2:224585155-224585177 GGGCAGCCGCGGCGGCGGCGGGG + Exonic
947418481 2:229921702-229921724 CGCCGGCGGCGGCGGGGCCGCGG - Intronic
947774553 2:232697439-232697461 GGGACGCGGCGGCGGGGCCGGGG - Intronic
948487238 2:238288710-238288732 GGGCGGCGGCGGCGGGCGCGGGG - Intronic
948560184 2:238847133-238847155 GCGCAGCGGAGGCTGGGCCCGGG + Intergenic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
948751668 2:240136699-240136721 GTGCAGCGGCCGTGGGGCCCTGG - Intronic
948824796 2:240568924-240568946 GGGCAGCGGGGGCGGCGGCGCGG - Exonic
948874850 2:240820826-240820848 GAGGCGAGGCGGCGGGTCCGCGG - Intergenic
1168804448 20:664207-664229 GGGCGGGGGCGGCGGGGACGCGG - Exonic
1168804453 20:664221-664243 TCGCGGCGGCGGCGGGGCGGGGG - Exonic
1169370921 20:5027866-5027888 CAGTAGGGGCGGCCGGGCCGAGG - Intergenic
1170015352 20:11775365-11775387 GTGCAGGGGCGGGGGGGCGGGGG - Intergenic
1170096332 20:12649637-12649659 GAGGAGGGGCGGAGGGGTCGGGG + Intergenic
1170163952 20:13343569-13343591 GGGCGGGGGCGGCGGGGCGGGGG - Intergenic
1170570529 20:17629796-17629818 GGGCGGCGGCAGTGGGGCCGGGG - Intronic
1170617819 20:17968520-17968542 GGCCGGCGGAGGCGGGGCCGTGG - Intronic
1171034703 20:21705839-21705861 GAGCCGCGGCGGCCCAGCCGCGG - Exonic
1171173450 20:23034972-23034994 GGTCTGCGGCGGCGGGGCTGGGG - Intergenic
1171266604 20:23776420-23776442 GGGCAGGGGCGGAGGGGCAGGGG - Intergenic
1171531006 20:25853725-25853747 GAGCGGCGGCTGCGGGGACTGGG + Intronic
1172015432 20:31870262-31870284 GGGCCGCGGCGGCCGGGGCGGGG + Intronic
1172037013 20:32018190-32018212 GAGGGGCGGGGGCGGGGGCGGGG + Intronic
1172037028 20:32018213-32018235 GAGGGGCGGGGGCGGGGGCGGGG + Intronic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172209254 20:33185551-33185573 CAGCCGGGGCGGCGGGGCAGAGG + Intergenic
1172284642 20:33732136-33732158 GCGCAGCGGCCGCGGGGCGGAGG + Intronic
1172338106 20:34133099-34133121 CAGCAGGGGCGGCCGGGCAGAGG - Intergenic
1172430173 20:34884022-34884044 GAGCAGGGGAGGCAGGGCAGAGG - Intronic
1172468586 20:35174964-35174986 GCGCAGCGGGGGCGGGGTCTGGG + Intronic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1172618721 20:36306448-36306470 GAGAGGCGGCGGCGGCGCAGCGG + Exonic
1172698078 20:36835851-36835873 GAGCAGCGGCGGCGGCGGCGGGG - Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1172721351 20:37001176-37001198 GGGCAGGGGCGGCCGGGCAGAGG - Intronic
1172845482 20:37927698-37927720 TGGCAGGGGCGGGGGGGCCGTGG + Intronic
1172883727 20:38217831-38217853 GGGGAGCGGGGGCGGGGGCGGGG - Intronic
1173251604 20:41366698-41366720 GACCAGCGGCGGGGGCGGCGCGG - Exonic
1174204267 20:48827815-48827837 GCCCGGCGGCGACGGGGCCGGGG - Exonic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1174380696 20:50153674-50153696 CGGCGGCGGCGGCAGGGCCGCGG + Exonic
1174380716 20:50153740-50153762 GCGCGGCGGCGGCGCGGGCGGGG + Intergenic
1174404438 20:50294345-50294367 GAGCAGCCGCGGCTGGGACTTGG + Intergenic
1175057163 20:56208895-56208917 GAGTGGCGGTGGCGGGGCGGGGG - Intergenic
1175057176 20:56208950-56208972 GAGTGGCGGTGGCGGGGCGGGGG - Intergenic
1175517252 20:59577472-59577494 GCGGAGCGGAGCCGGGGCCGCGG - Intergenic
1175749214 20:61483675-61483697 GGGCAGCGGGGGCGGGGCGGGGG - Intronic
1175877793 20:62238643-62238665 GAGCTGCGGGGCCTGGGCCGCGG + Intronic
1176015532 20:62929320-62929342 GAGCAGCGGGGGAGGGGCACGGG + Intronic
1176029798 20:63006476-63006498 GAGCAGCGGCGGCGGCGGCGCGG - Exonic
1176120171 20:63450677-63450699 GAGCAGCGTCTGTGGAGCCGAGG + Intronic
1176159764 20:63642088-63642110 AAGGTGCGGGGGCGGGGCCGGGG - Exonic
1176283289 20:64327587-64327609 GAGCAGCCCCAGCGGGGCCCTGG - Intergenic
1176380700 21:6111027-6111049 GGGCGGCGGGGGCGGGGCAGGGG + Intergenic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556825 21:8257546-8257568 GAGGAGGGGCGGCGGGGAGGAGG - Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575764 21:8440587-8440609 GAGGAGGGGCGGCGGGGAGGAGG - Intergenic
1176583084 21:8549517-8549539 AAGCCGCGGCGTCGGGGGCGGGG - Intergenic
1177011090 21:15730513-15730535 AGGCGGCGGCGGCGAGGCCGGGG - Intronic
1177014990 21:15775745-15775767 GTGCAGCGGGGGCGGGGGGGGGG - Intronic
1177166556 21:17611711-17611733 GAGCAGCCGCCGCGGTGACGAGG - Intronic
1177431693 21:20998277-20998299 GGGCGGCGGGGGCGGGGGCGCGG - Intergenic
1178487050 21:33025861-33025883 CGGCAGCGGTGGCGGGGGCGGGG - Intronic
1178914671 21:36699664-36699686 GGGCTGCGGCGGCGGGGATGGGG - Exonic
1179195254 21:39157509-39157531 CAGCAGGGGCGGCCGGGCAGAGG - Intergenic
1179422452 21:41247649-41247671 GAGGCGGGGCGGCGGGGCCGTGG + Intronic
1179561584 21:42219215-42219237 CGGCGGCGGCGGCGGGGACGAGG - Exonic
1179742772 21:43427213-43427235 GGGCGGCGGGGGCGGGGCAGGGG - Intergenic
1179810169 21:43865151-43865173 TGGCGGCGGCGGCGCGGCCGAGG + Intergenic
1179989561 21:44940126-44940148 GGGCAGGGGGCGCGGGGCCGGGG - Exonic
1180101818 21:45590975-45590997 GAGAGGCGGAGGCGGGGGCGGGG + Intergenic
1180534543 22:16386774-16386796 AAGCCGCGGCGGCGGGGGTGGGG - Intergenic
1180559045 22:16601351-16601373 CAGCGGCGGCGGCGCGTCCGCGG + Intergenic
1180942569 22:19668933-19668955 GAGCTGCGGTCGCGGGGGCGGGG + Intergenic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180960533 22:19760583-19760605 GAGCCGCGGCGGGCGGGCTGGGG + Intronic
1180960687 22:19761049-19761071 CGGCGGCGGCGGCGGGCCCGGGG - Exonic
1180965139 22:19784309-19784331 CAGCAGCGGCGGCGGGTCCTGGG + Exonic
1180980703 22:19876812-19876834 GAGCAGCTGTGGCCAGGCCGGGG + Intronic
1181471344 22:23142036-23142058 CAGCAGCGTCCGCGGCGCCGCGG + Exonic
1181478031 22:23180590-23180612 GCACGGCGGCGGCGGGGCTGTGG + Exonic
1181902677 22:26169317-26169339 GAGGGGCCGCGGCGGCGCCGGGG - Intergenic
1182475519 22:30574588-30574610 CGGCAGCGGCGGCGGGGGCGGGG - Intergenic
1183370128 22:37427490-37427512 GAGGCGCGGCGGCGGGGAGGAGG - Intergenic
1183381183 22:37491337-37491359 GAGCTGCTGCGGCAGTGCCGTGG - Exonic
1183407901 22:37639506-37639528 CAGCAGCGGGGGCCCGGCCGGGG + Exonic
1183452859 22:37906269-37906291 GAGGGGCGGAGGCGGGGCCGCGG - Intronic
1183601707 22:38843895-38843917 CAGGCGCGGCGGCGGGGTCGGGG + Exonic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
1184169443 22:42750516-42750538 CAGCAGGGGCGGCCGGGCAGAGG + Intergenic
1184347748 22:43923890-43923912 TGGCGGCGGCGGCGGGGCGGGGG - Exonic
1184377822 22:44125616-44125638 AAGAAGCGGAGGCGGGGCCCAGG + Intronic
1184465898 22:44668775-44668797 TGGCAGCGGCGGCGGCGGCGCGG + Intronic
1184593858 22:45502815-45502837 GCGCGGCGGAGGCGGGGCCGCGG - Intronic
1184755707 22:46514690-46514712 GAGCCGGGGCTGCAGGGCCGAGG + Intronic
1184759601 22:46537150-46537172 GGGCGGCGGCGGCGGCGCCATGG + Exonic
1184766915 22:46576989-46577011 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1184876283 22:47277712-47277734 GAGCACAGGCGGCGGGCCCCAGG - Intergenic
1185278753 22:49961037-49961059 GCGCGGGGCCGGCGGGGCCGGGG + Intronic
1185296700 22:50058282-50058304 GTGCAGCGGCGGCGGCCCCGGGG + Intergenic
1185335163 22:50268070-50268092 GAGCTGGGGCGGCGGGGCCGGGG - Intronic
1185371304 22:50462159-50462181 GCCCAGTGGAGGCGGGGCCGTGG - Intronic
1185397649 22:50600959-50600981 GGGCTGGGGCGGCGGGGACGGGG - Intronic
1203253815 22_KI270733v1_random:129641-129663 GAGGAGGGGCGGCGGGGAGGAGG - Intergenic
1203261871 22_KI270733v1_random:174720-174742 GAGGAGGGGCGGCGGGGAGGAGG - Intergenic
950040272 3:9915554-9915576 GAGCAGCAGCAGCGGGCGCGGGG - Exonic
950153844 3:10708046-10708068 GGCGGGCGGCGGCGGGGCCGCGG - Intergenic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950487783 3:13283029-13283051 GGGCGGCGGCGGCGCGGCCATGG + Intergenic
950683917 3:14603026-14603048 GCCCGGCGGGGGCGGGGCCGGGG - Intergenic
950730091 3:14948583-14948605 GGTCGGCGGGGGCGGGGCCGGGG + Intronic
951543632 3:23806119-23806141 GAGGCCCGGCGGCGCGGCCGGGG - Intronic
951803465 3:26622678-26622700 GAGCAGCGCCGGCGAGGCACTGG + Intergenic
953959562 3:47256572-47256594 CAGCAGGGGCGGCCGGGCAGAGG - Intronic
954223082 3:49166295-49166317 GAGCAGCGGAGGCGGCGCAGAGG - Exonic
954367598 3:50154832-50154854 GCGAAGCGGGGGCGGGGGCGAGG + Intergenic
954367633 3:50154924-50154946 GTGGAGCGGGGGCGGGGCGGTGG + Intergenic
954540814 3:51391998-51392020 GAGCAGCAGCTGCCGGGCCAGGG - Exonic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
954967791 3:54626332-54626354 CAGCAGCGGCGGCTGAACCGGGG + Intronic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
955997027 3:64688045-64688067 GGGCGGAGGCGGGGGGGCCGCGG + Intergenic
956062000 3:65357094-65357116 GTGGACCGGTGGCGGGGCCGTGG + Exonic
956420236 3:69080022-69080044 GACCAGCCGCAGCGGGCCCGGGG - Intronic
956658976 3:71581620-71581642 GGGCAGCGGCAGCGGCGCCGGGG - Intronic
957079369 3:75623520-75623542 GAGCGGGGGGGGCGGGGCAGGGG - Intergenic
959221895 3:103531476-103531498 CAGCAGGGGCGGCTGGGCAGAGG + Intergenic
960224011 3:115148086-115148108 GAGCTGCGCCGGGGGAGCCGCGG + Intergenic
960658150 3:120028834-120028856 GAGCAGCCGTGGCGGGGCTAGGG - Intronic
960864285 3:122184284-122184306 GAGCTCCGGGGCCGGGGCCGGGG + Intronic
961028865 3:123584964-123584986 GGGCGGCGGTGGCAGGGCCGGGG - Exonic
961408926 3:126704402-126704424 GAGCGGCGCCGCCTGGGCCGGGG + Intronic
961448204 3:126990973-126990995 GAGCAGGGGAGGCTGGGCCAGGG - Intronic
961545409 3:127629535-127629557 GAGCCGCGGCGTGGGGGCCACGG - Intronic
961585030 3:127915339-127915361 GGGCAGCGGCGGCGTGGTCTCGG + Exonic
961780065 3:129316021-129316043 GAGCGGCCGCGGCCGGGCCTGGG + Exonic
961816996 3:129556186-129556208 GAGCAGAGACGGCTGGGGCGGGG - Exonic
961817532 3:129558932-129558954 GAGCAGCTGTGGCAGGGCTGTGG + Intronic
961827164 3:129605277-129605299 CGGCGGCGGCGGCGGGGGCGGGG - Intronic
962277951 3:134030031-134030053 CGGCGGCGGCGGCGGGGCGGGGG - Exonic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
962809131 3:138946738-138946760 GAGCAGAGGCGGCCCGGCCGCGG - Exonic
962919139 3:139935428-139935450 GAGCGGCAGCGGCGGTGGCGGGG + Exonic
963091393 3:141486919-141486941 GGGGGGCGGGGGCGGGGCCGCGG + Intergenic
963888123 3:150603518-150603540 GAGGCGCGGCGGGGTGGCCGGGG - Intronic
964118969 3:153162643-153162665 GCGCAGCCCCGACGGGGCCGCGG + Exonic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966592272 3:181696064-181696086 GCGCAGCGGCGCCAGGTCCGAGG - Intergenic
966743394 3:183254072-183254094 GAGGAGGCGCGGCGGGGCGGGGG - Intronic
967033720 3:185631609-185631631 GAGCAGGGGCTGCGGGGGGGGGG - Exonic
968178100 3:196568750-196568772 GAGCCGCGGAGGAGGGGCGGAGG + Exonic
968178187 3:196569035-196569057 TAGCGGCGGCGGCGCGGGCGCGG + Exonic
968436375 4:592370-592392 CAGCAGGGGCGGCCGGGCAGAGG - Intergenic
968494529 4:907979-908001 GAGCGGCGGGGACAGGGCCGGGG - Intronic
968563917 4:1299376-1299398 GAGCAGCAGCAGCTGGGCCTGGG - Intronic
968667017 4:1827982-1828004 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
968667362 4:1828746-1828768 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
968728850 4:2260532-2260554 GAGAAGCGGCAGCGGGGGCCGGG + Intronic
969295660 4:6269589-6269611 GCGGGGCGGGGGCGGGGCCGGGG + Intergenic
969436632 4:7192711-7192733 GCGCGGCGGCGGCGGAGCCCCGG - Exonic
969714466 4:8861592-8861614 GAGCAGCGTAGGCGGAGCCCCGG + Intronic
969715851 4:8867786-8867808 GAGCAGCGGTGGGGGCGGCGCGG + Exonic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970333016 4:15003729-15003751 CGGCGGCGGCGGCGGGGGCGGGG + Exonic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
971457807 4:26860791-26860813 GCGCCGCGGCGGCGGCGGCGCGG + Intronic
973317714 4:48779587-48779609 CAGCCGAGGCGGCGGAGCCGTGG + Intronic
973635944 4:52862208-52862230 GCGGAGCGGCGCCGGGGGCGGGG + Intergenic
974590586 4:63943061-63943083 GCGCAGCGCCGGTGGGGCTGAGG + Intergenic
975701916 4:77075447-77075469 GAGGGGCGGGGGCGGGGGCGGGG - Intronic
975870767 4:78776346-78776368 GGGCAGCTGCAGCGGAGCCGCGG + Intronic
975870832 4:78776579-78776601 CGGCAGCGGCGGCGGAGCGGCGG + Exonic
976629373 4:87220699-87220721 GAGCCGCGGGGGCGAGGCCGTGG - Intronic
977064977 4:92303907-92303929 GAGCAGCGGGGCCGGGCCAGAGG - Intronic
977607225 4:98995555-98995577 GCGGGGCGGGGGCGGGGCCGGGG + Intergenic
977894004 4:102344585-102344607 GAGGAGTGGCGGAGGGGCCAGGG - Exonic
978157004 4:105500723-105500745 CAGAAGGGGCGGCGGGGCAGAGG + Intergenic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
978620143 4:110629392-110629414 GAGGCGCGGGGGCGGGGCGGCGG + Intronic
978885371 4:113761516-113761538 GTGCAGCGGGGCCGAGGCCGCGG + Intronic
981615458 4:146639371-146639393 CAGCAGCGGCGGCGGGGGCTCGG + Exonic
982042367 4:151409032-151409054 GGCCGGCGGCGGCGGGGGCGGGG + Intergenic
982042371 4:151409038-151409060 CGGCGGCGGGGGCGGGGCCGGGG + Intergenic
982357934 4:154490305-154490327 GGGTAGCGGCGGCGGGGCACTGG - Intronic
982615600 4:157636389-157636411 CAGGAGGGGCGGCGGGGCAGAGG + Intergenic
983218175 4:165020264-165020286 CAGCCGGGGCGGCGGGGCAGAGG + Intergenic
983604694 4:169570607-169570629 TAGCAGGGGCGGCCGGGCAGAGG - Intronic
983904383 4:173169032-173169054 GAGCAGGGGCGGCGGGGTCGCGG + Intronic
984641915 4:182175914-182175936 GTGCAGCGGCGGCAGGGTGGGGG - Intronic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
985427310 4:189843492-189843514 CAGCAGCTGCGGCTGGGCCTAGG - Intergenic
985577459 5:680143-680165 CAGCAGGGGCGCAGGGGCCGCGG - Intronic
985592391 5:772239-772261 CAGCAGGGGCGCAGGGGCCGCGG - Intergenic
985765901 5:1779489-1779511 GCGTAGCGGCCGCAGGGCCGAGG + Intergenic
986608624 5:9546177-9546199 GCGGCGCGGCGGCGGGGGCGGGG - Intergenic
987469457 5:18310155-18310177 CAGCAGGGGCGGCCGGGCAGAGG - Intergenic
988564834 5:32312706-32312728 GGGCAGGGGCGGCCGGGGCGAGG - Intronic
988577885 5:32444430-32444452 GAGCAGCCCTGGCGGGGCCCAGG + Intronic
990410357 5:55535089-55535111 GTGCAGCAGGGGCGGGGCCAGGG + Intergenic
990910213 5:60844436-60844458 GCGCGGCGGAGGCGAGGCCGGGG - Intergenic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
990955102 5:61332653-61332675 CAACACCGGCGGCGGCGCCGCGG + Exonic
991907085 5:71525199-71525221 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
991909956 5:71551674-71551696 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
991909969 5:71551711-71551733 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
992067298 5:73120170-73120192 GAGCGGCGGCGTGGGGGGCGCGG - Intergenic
992098345 5:73382206-73382228 AAGCCGCGCTGGCGGGGCCGCGG + Intergenic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992151579 5:73909700-73909722 GAGCTGCTGCTGCGGAGCCGGGG + Exonic
992431597 5:76715993-76716015 GAGCGGCGGCTGAGGGACCGCGG + Intergenic
992473112 5:77077231-77077253 GAGCGGCGGCGGCGCAGCGGGGG + Exonic
992716221 5:79513942-79513964 AAGAGGCGGCGGCGGGGCCCGGG - Exonic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
993901108 5:93584794-93584816 CAGCAGCAGCGGGGCGGCCGAGG + Exonic
994072735 5:95620476-95620498 GTGCGGCGGCGGCGGGCCCTGGG + Exonic
995574309 5:113513634-113513656 GCGCAGCGGCGGCCGCGCTGAGG + Intergenic
996948193 5:129094802-129094824 CAACAGCGGCGCCGGGGGCGCGG + Exonic
997201314 5:132011640-132011662 CGGCAGCGGCGGCGGCGGCGCGG - Exonic
997206062 5:132050872-132050894 GGGGAGCTGCGGCAGGGCCGTGG + Intergenic
997652888 5:135535464-135535486 CAGGAGAGGCGGCGGCGCCGCGG - Exonic
998067625 5:139171130-139171152 CAGTAGGGGCGGCGGGGCAGAGG - Intronic
998074486 5:139224719-139224741 CAGTAGGGGCGGCGGGGCAGAGG - Intronic
999248268 5:150166971-150166993 GGGCGCCGGGGGCGGGGCCGGGG - Exonic
1001070293 5:168579527-168579549 GAGCGGCTGCGGGGGGGCCCCGG - Exonic
1002771276 6:292448-292470 GAGGAGCGGCGGGGCGGGCGGGG - Exonic
1002927148 6:1611183-1611205 GGGCAGCGGCAGCGCCGCCGCGG + Exonic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1002928613 6:1619143-1619165 CAGCAGCGGCTGGGGAGCCGGGG + Intergenic
1003123239 6:3335266-3335288 CAGCAGCGGCGGAGGCTCCGAGG + Intronic
1004193872 6:13487271-13487293 GGGCTGCGGCGGCGCGGCCGCGG - Exonic
1004199611 6:13535653-13535675 GTGCAGGGGCGGCGGGGGCAGGG - Intergenic
1004216780 6:13711248-13711270 CGGCGGGGGCGGCGGGGCCGCGG + Exonic
1004492394 6:16129166-16129188 GAGTGGCGGCCGCGGGGCCCCGG + Exonic
1004614958 6:17281079-17281101 GGGGCGCGGCGGCGGGGCCAGGG - Intergenic
1005606975 6:27485473-27485495 CAGTAGGGGCGGCCGGGCCGAGG + Intergenic
1006141400 6:31932053-31932075 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
1006148854 6:31975844-31975866 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
1006231833 6:32594747-32594769 CAGCAGGGGCGGCCGGGCAGAGG + Intergenic
1006337402 6:33427883-33427905 TAGCAACGGCGGCGGGGCCCGGG + Intronic
1006395542 6:33784738-33784760 GAGCAGAGGCGACGTGGTCGGGG + Intronic
1006414063 6:33893050-33893072 GAGGGGCCGGGGCGGGGCCGGGG + Intergenic
1006614733 6:35318532-35318554 GAGCGCCGGGGGCGGGGCCTGGG + Intronic
1006725502 6:36196795-36196817 CGGCGGCGGCGGCCGGGCCGGGG + Exonic
1007429945 6:41770911-41770933 GAGCCGCGGCGGCGGGTCAGTGG + Exonic
1007698148 6:43746933-43746955 GAGCACGGGCAGCGGAGCCGTGG - Intergenic
1007781401 6:44256973-44256995 GAGCTGCAGCGGAGGGGGCGGGG - Intronic
1010414874 6:75601813-75601835 GGGCGGCGGCGTCGGGGCGGGGG + Intronic
1010428164 6:75749145-75749167 GGGCGGGGGCGCCGGGGCCGCGG - Intergenic
1010703303 6:79077772-79077794 AGGCGGCGGCGGCGGGGCCGCGG - Intronic
1010781177 6:79947429-79947451 GCGCCGCGGCGGCGGGGATGCGG + Exonic
1012137540 6:95577681-95577703 CAGCAGCGGCGGCAGGCACGAGG + Intronic
1013472411 6:110476829-110476851 GAGCGGCGGCGCTGGGGGCGAGG - Intergenic
1013638060 6:112047708-112047730 CAGAAGGGGCGGCGGGGCAGAGG - Intergenic
1014272541 6:119349855-119349877 GTCCCGCGGGGGCGGGGCCGAGG + Intergenic
1014632377 6:123803361-123803383 AAGCGGCGGCGGCGGGGACCGGG - Intergenic
1014724952 6:124962568-124962590 GAGCGGCGGCGGCGGGCCCCAGG + Exonic
1014800397 6:125771076-125771098 CAGCAGGGGCGGCCGGGCAGAGG - Intergenic
1014925643 6:127267069-127267091 GAGGGGCGGCGGCGGGGTCAGGG + Intronic
1015149344 6:130020221-130020243 GCGCCGCGGCGGCGGGGCGGGGG + Intronic
1015654127 6:135497836-135497858 GAGGCGCGGGGACGGGGCCGCGG - Intergenic
1016010835 6:139135791-139135813 GGGCAGCCGCGGCGGGGCGGAGG - Intronic
1016378718 6:143450808-143450830 GAGCGGCGGCGGCTGCGCGGCGG + Intronic
1017672160 6:156778447-156778469 GCTCAGCAGCGGCGGGCCCGGGG - Exonic
1017793703 6:157823303-157823325 GAGGAGCGGCCGCCGCGCCGGGG + Exonic
1018330922 6:162727295-162727317 GAGGGGCGGCGGCGGGGCGAAGG + Intronic
1018669615 6:166167885-166167907 GAGCCGCGGCGGCAGCGCTGGGG + Intronic
1018686309 6:166307438-166307460 GAGCATCGGCCGCAGGGCCCCGG + Exonic
1019111939 6:169724040-169724062 GGGCGGAGGGGGCGGGGCCGGGG - Exonic
1019303692 7:322380-322402 GGGCGGCGGGGGCGGGGCCTGGG - Intergenic
1019440587 7:1044445-1044467 TAGCCGCGAGGGCGGGGCCGGGG + Intronic
1019536163 7:1530912-1530934 GGGCAGCGGGGCCCGGGCCGCGG + Intronic
1019541580 7:1554059-1554081 GAGCCGCGGAGGCAGTGCCGAGG - Intronic
1019544982 7:1569900-1569922 GGGCCGCGGCTGCAGGGCCGGGG - Exonic
1019663909 7:2241944-2241966 GGGCAGGGCCGGCGGGGCCGTGG - Intronic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1019725243 7:2598546-2598568 GAGCAGGGGGAGCGGGGCCGCGG - Exonic
1020007075 7:4788761-4788783 GAGCAGTGGCGACGTGGCCCCGG + Intronic
1020035011 7:4959300-4959322 CAGCGGAGGCGGCGGGGTCGCGG - Intergenic
1020037604 7:4974243-4974265 GAGCTGCGGGGGTGGGGGCGGGG + Intergenic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1020278335 7:6637575-6637597 GCGGGGAGGCGGCGGGGCCGGGG + Intronic
1020281784 7:6653552-6653574 TTTCGGCGGCGGCGGGGCCGCGG + Exonic
1021451251 7:20785336-20785358 GGGCAGCGGCGGCGGCGGCGGGG - Exonic
1021827987 7:24573550-24573572 GAGCGGCGGCAGCGGCGGCGCGG + Exonic
1021828053 7:24573757-24573779 AGGCGGCGGCGGCGGCGCCGCGG + Intronic
1022018575 7:26376696-26376718 GGGCGGCCGCGCCGGGGCCGGGG + Intergenic
1022101918 7:27174003-27174025 GGGCAGCGGTGGCGGTGGCGGGG - Exonic
1022715152 7:32891892-32891914 GCGCGGCGGGGGCGGGGGCGGGG - Exonic
1022923420 7:35037699-35037721 GGGCGGCGGGGGCGGGGCCGCGG - Intronic
1023637074 7:42222981-42223003 GAGCAGGGGCGGGGGGACGGCGG - Intronic
1023818273 7:43966234-43966256 GAGGAGGGGGGGCGGGGCGGTGG + Intergenic
1023875830 7:44285818-44285840 GAGGCGCGGCGGAGGGGGCGCGG + Intronic
1024639365 7:51316884-51316906 GAGCAGCCGGGGCGGGGGCGCGG - Intergenic
1024980379 7:55153164-55153186 GAGCAGTGGTGGAGGAGCCGAGG - Intronic
1025296189 7:57776714-57776736 GAGCGGCGGCTGCGGGGACTCGG - Intergenic
1026765165 7:73155458-73155480 GCGAAGCGGCGGCGGGGGCGGGG - Intergenic
1026840433 7:73667776-73667798 GAGCCGCGGCGCCGGGGCTGGGG - Intergenic
1026923666 7:74174301-74174323 CAGCCCCGGCGGCGGGGCGGGGG + Exonic
1027041638 7:74965213-74965235 GCGAAGCGGCGGCGGGGGCGGGG - Intronic
1027082004 7:75237156-75237178 GCGAAGCGGCGGCGGGGGCGGGG + Intergenic
1028762314 7:94509848-94509870 GAGCAGCGGCGGCGGGGCTGGGG + Exonic
1029123187 7:98281711-98281733 CGGCGGCGGCGGCGGGGACGCGG - Exonic
1029279679 7:99427534-99427556 CAGCAGGGGCGGCCGGGCAGAGG - Intronic
1029362764 7:100099330-100099352 GAGCAGCGGAGTCGGGACCCTGG - Exonic
1029390587 7:100271701-100271723 GCGAAGCGGCGGCGGGGGCGGGG + Intronic
1029711117 7:102300565-102300587 GGGCGGCTGCGGCGGGGCCAGGG - Exonic
1029742903 7:102501066-102501088 GAGGAGGGGGGGCGGGGCGGTGG + Intronic
1029760893 7:102600227-102600249 GAGGAGGGGGGGCGGGGCGGTGG + Intronic
1030033302 7:105388466-105388488 GAGGGGCGGCGGCGGGGGAGGGG - Intronic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1032074534 7:128830241-128830263 GGGGAGGGGCGGCGGGGGCGGGG + Intergenic
1032087160 7:128890524-128890546 GGGCAGGGGCTGGGGGGCCGTGG + Intronic
1032391253 7:131556670-131556692 GAGGGGCGGGGGCGGGGGCGGGG - Intronic
1032525590 7:132576748-132576770 GAGCAGCGGCGGCGGCTCTCGGG + Exonic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1033253097 7:139777514-139777536 GGGCTGCGGGCGCGGGGCCGCGG + Intronic
1033311752 7:140266784-140266806 GAGCTGCGGCGGCGGTGGAGGGG - Intergenic
1034243129 7:149624672-149624694 GAGCAGCGGCGGCAGAGACAGGG - Intergenic
1034483543 7:151341739-151341761 CGACAGCGGCGGCGGGGGCGGGG + Exonic
1034483598 7:151341944-151341966 GTGGAGCGGCCGCGGGGCGGGGG + Intronic
1034618274 7:152436656-152436678 CAGCGGCGGCGGCGCGTCCGCGG - Intergenic
1035168598 7:157005765-157005787 GAAGGGCGGCGGCGGGGGCGCGG - Exonic
1035337568 7:158139675-158139697 AAGCAGCGGGGGCGGGGCGGGGG + Intronic
1035357070 7:158282495-158282517 GAGCAGCGGGGTCGAGGCTGCGG + Intronic
1035385938 7:158472860-158472882 CAGCAGTGGCGGCGGGGCGGGGG + Intronic
1036397009 8:8378193-8378215 GTGCAGGGGCGCTGGGGCCGGGG + Intronic
1036561440 8:9903289-9903311 GCGCAGCGGCCGCGGGCGCGAGG - Intergenic
1036701576 8:11016676-11016698 CAGAGGCGGAGGCGGGGCCGGGG - Intronic
1036789514 8:11708708-11708730 CAGCAGTGGCGGCGGAGCGGCGG + Exonic
1037487223 8:19358936-19358958 GTGGAGGGGCGGAGGGGCCGAGG - Intronic
1037578577 8:20230894-20230916 GAGCAGTGGTGGCTGGGCCTCGG - Intergenic
1037769203 8:21789118-21789140 TGGCGGCGGCGGCGGCGCCGGGG + Intronic
1038808006 8:30812495-30812517 GGGGAGCGGCGCCCGGGCCGGGG - Exonic
1039845330 8:41321642-41321664 GGGCGGCGGGGGCAGGGCCGGGG + Intergenic
1041330253 8:56716504-56716526 GAGCAGCAGGGGTGGGGCTGGGG - Intergenic
1041552604 8:59118809-59118831 GAGCGGCGGTGGCCGGGCCGCGG - Intronic
1041676854 8:60547766-60547788 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
1041676979 8:60548069-60548091 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
1041677079 8:60548323-60548345 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
1041690145 8:60679618-60679640 GAGCAGCGGCGGCGGCGGCTCGG + Intronic
1041839166 8:62248948-62248970 GAGCGGCGGCCGCGGGGCCGAGG + Exonic
1042902792 8:73746239-73746261 GAGGCGGAGCGGCGGGGCCGGGG - Intronic
1043296132 8:78665990-78666012 GATCCGTGGGGGCGGGGCCGCGG - Intergenic
1043563483 8:81522270-81522292 GAGCGGCGGCGGGGGGACCTTGG + Intergenic
1043847321 8:85177657-85177679 GAGCTCCGGAGGCGGGGACGGGG + Intronic
1044306531 8:90646142-90646164 GGCCAGAGGGGGCGGGGCCGCGG + Intronic
1047000978 8:120571999-120572021 CAGCAGCGGGGGTGGGGCCGGGG - Intronic
1048308061 8:133297287-133297309 GAGGCGCGGGGGCGGGGCCGCGG - Exonic
1049177289 8:141202114-141202136 CAGCAGGGGCGGCCGGGCAGAGG + Intergenic
1049417129 8:142500326-142500348 GAGGAGCGGCGCGGGGGGCGGGG - Intronic
1049419586 8:142510871-142510893 CGTCAGCGGCGGCGGGGACGCGG - Intronic
1049460912 8:142727325-142727347 TAGCGGCGGCGGCGGGCGCGGGG - Exonic
1049621071 8:143598562-143598584 GGCCGGGGGCGGCGGGGCCGGGG - Exonic
1049811912 8:144579452-144579474 GAGCAGCGGAGGCTCGGGCGTGG - Intronic
1050091297 9:2017666-2017688 CAGCGGCGGGGGCCGGGCCGCGG + Intronic
1050558327 9:6808045-6808067 CAGCAGGGGCGGCCGGGCAGAGG - Intronic
1051146201 9:14030195-14030217 GAGCAGCAGCGGGGGGGGGGGGG + Intergenic
1051146209 9:14030215-14030237 GGGTGGCGGCGGCGGGGCCAGGG + Intergenic
1051170626 9:14315504-14315526 GTGCAGGCGGGGCGGGGCCGCGG + Intronic
1051258187 9:15234459-15234481 CAGCAGGGGCGGCCGGGCAGAGG - Intronic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1053016452 9:34665060-34665082 GGGCAGCGGCGGTGGGGCTGCGG + Exonic
1053138277 9:35665241-35665263 GAGCCGCGGAGGCGGGGCCGGGG + Exonic
1053306209 9:36986345-36986367 GCGCGGCCGCGGCGGGGCCCGGG - Intronic
1053690490 9:40584409-40584431 GGGCGGCGGCGGCGGCGCGGCGG - Intergenic
1054407536 9:64774433-64774455 AAGCCGCGGCGGCGGGGGGGGGG + Intergenic
1054434097 9:65196116-65196138 GGGCGGCGGCGGCGCGGCGGAGG - Intergenic
1054434106 9:65196145-65196167 GGGCGGCGGCGGCGCGGCGGAGG - Intergenic
1054496294 9:65825569-65825591 GGGCGGCGGCGGCGCGGCGGAGG + Intergenic
1054842666 9:69760048-69760070 CGGCCGCGGCGGCGGGGACGCGG - Intergenic
1056386282 9:86099588-86099610 GAGCAGCGCCGGCGGCGCGAAGG + Intronic
1056659697 9:88534944-88534966 GCGCAGTGGGGGCGGGGGCGGGG + Intergenic
1057488632 9:95506092-95506114 CGGCAGCGGCGGCGGGCCCGGGG + Intronic
1057488651 9:95506156-95506178 GAGCGGCGGGGGCGGGACGGGGG - Intronic
1057693412 9:97307266-97307288 GAAAAGCGTGGGCGGGGCCGGGG + Intergenic
1057773162 9:97984464-97984486 GTGCCGCGGCGGCGGCGCCCGGG + Intronic
1057922092 9:99105482-99105504 GGGGAGCGGAGGCGGGGCAGGGG + Intronic
1058058463 9:100472974-100472996 GGGCAGGGGCGCGGGGGCCGGGG - Intronic
1058484850 9:105433615-105433637 AAGCAGGGGCGGCGGGGGAGTGG - Intronic
1058723116 9:107777533-107777555 CAGCAGGGGCGGCCGGGCAGAGG - Intergenic
1059394787 9:114027618-114027640 GAGCAGAGGTGGCGGGCCAGGGG + Intronic
1060087282 9:120714214-120714236 CACCGGTGGCGGCGGGGCCGCGG - Exonic
1060228060 9:121808246-121808268 GAGCAAGGGCGGAGGAGCCGGGG + Intergenic
1060300258 9:122370966-122370988 GAGGAGCGGGGGTGGAGCCGGGG + Intronic
1060412190 9:123407150-123407172 GAGCAGGGGGGGAGGGGCGGGGG + Intronic
1060468739 9:123930174-123930196 GGGCAGCGGCGGCGGCAGCGCGG - Intergenic
1060821757 9:126665307-126665329 GGGCTGGGGCGGCGGGGGCGGGG + Intronic
1061028954 9:128068264-128068286 GAGCGGGGGCGGCGGGCCGGCGG - Exonic
1061181660 9:129028202-129028224 TGGCGGCGGCGGCTGGGCCGGGG - Exonic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061208312 9:129176910-129176932 GAGCGGCGGCGGCTGCTCCGAGG + Exonic
1061262629 9:129488535-129488557 GAGAGGCGGCCGCGGGGCGGGGG - Intergenic
1061384741 9:130282588-130282610 GAGCAGAGGGGCCGGGGCCACGG + Intergenic
1061610039 9:131740024-131740046 GGGGAGCGGCGGCGGGCGCGCGG - Intronic
1061666390 9:132162911-132162933 GAGCAGAGGCGGCGGGAAGGCGG + Intronic
1061898087 9:133658838-133658860 GAGCAGCGGGGCGGGGGCGGGGG - Exonic
1062245728 9:135565182-135565204 GAGCAGAGGGGGCCGGGCCAAGG + Intronic
1062254728 9:135615457-135615479 GACCAGGGACGGCGGGGACGTGG + Intergenic
1062361972 9:136192707-136192729 TTGCAGCGGGGGCGGGGCTGGGG - Intergenic
1062491723 9:136808135-136808157 GCTCAGCGGCGGCGGGGAAGGGG - Exonic
1062556350 9:137114865-137114887 GGGCAGCGGCCGCGGGGCGCGGG - Intronic
1062558713 9:137129598-137129620 AAGCAGCGGCGGCGGATGCGTGG + Intergenic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062659100 9:137619089-137619111 GGGCAGCGGCGGAGGCGGCGCGG + Intronic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1203470215 Un_GL000220v1:112789-112811 GAGGAGGGGCGGCGGGGAGGAGG - Intergenic
1203478036 Un_GL000220v1:156761-156783 GAGGAGGGGCGGCGGGGAGGAGG - Intergenic
1203613065 Un_KI270749v1:27382-27404 AAGCCGCGGCGTCGGGGGCGGGG - Intergenic
1185621487 X:1453411-1453433 GAGCGCCGGGGGCGGGGACGGGG - Intronic
1185736644 X:2500931-2500953 AAGCGGCGGCGGCGCGGCCGGGG - Exonic
1186426088 X:9465199-9465221 CTGCGGCGGCGGCGGGGCGGGGG - Exonic
1187181355 X:16946571-16946593 GGGAGGCGGGGGCGGGGCCGGGG + Intergenic
1187403658 X:18984142-18984164 GAGGCGCGGGGGCGGGGACGGGG + Exonic
1187419545 X:19122534-19122556 GAGCGGCGGGGGCGGCGCCGAGG - Exonic
1187507284 X:19887784-19887806 GAGGGGCGGGGCCGGGGCCGGGG + Intergenic
1189320413 X:40083898-40083920 GAGAAGGTGCGGCGGGGCCTCGG - Intronic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1190008062 X:46758964-46758986 CAGCCGCGGCGGCGGCGCCCCGG + Exonic
1190126823 X:47712972-47712994 GACCAGGGGCGGGGAGGCCGGGG + Intergenic
1192177645 X:68895816-68895838 GAGCAGCGGGGGCAGGGAGGTGG - Intergenic
1192705550 X:73526116-73526138 GAGCGGCGGCTGCGGCTCCGGGG - Intergenic
1193114795 X:77766254-77766276 CAGCAGGGGCGGCCGGGCAGAGG + Intronic
1195009900 X:100724069-100724091 CAGCAGGGGCGGCCGGGCAGAGG - Intronic
1195903838 X:109825082-109825104 CAGCAGCTGCTGCTGGGCCGGGG + Intergenic
1195954792 X:110317828-110317850 GGGCTGCGGCGGCGGCGGCGGGG - Exonic
1197199352 X:123734412-123734434 CAGTAGCGGCGGCCGGGCAGAGG - Intergenic
1197981018 X:132217996-132218018 GAGCAGCAGCGCTGGGGCAGCGG - Exonic
1199600674 X:149539746-149539768 GAGCAGATGGGGCGGGGCTGCGG - Intergenic
1199649868 X:149940044-149940066 GAGCAGATGGGGCGGGGCTGCGG + Intergenic
1199772734 X:150984361-150984383 GGGCGGCGGCGGCGGGGCCCGGG + Intronic
1200058740 X:153474700-153474722 GAGAGGCGGGGGCGGGGGCGGGG + Intronic
1200387454 X:155907915-155907937 CAGAAGGGGCGGCGGGGCAGAGG + Intronic