ID: 955820337

View in Genome Browser
Species Human (GRCh38)
Location 3:62889768-62889790
Sequence CAAGCAGGTGGTATCATGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955820337_955820341 3 Left 955820337 3:62889768-62889790 CCTATCATGATACCACCTGCTTG No data
Right 955820341 3:62889794-62889816 TGCCCAAGAGTCCAGTGTGCAGG No data
955820337_955820344 6 Left 955820337 3:62889768-62889790 CCTATCATGATACCACCTGCTTG No data
Right 955820344 3:62889797-62889819 CCAAGAGTCCAGTGTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955820337 Original CRISPR CAAGCAGGTGGTATCATGAT AGG (reversed) Intergenic
No off target data available for this crispr