ID: 955820972

View in Genome Browser
Species Human (GRCh38)
Location 3:62895056-62895078
Sequence CCTCAGATAAGGGAGCTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955820964_955820972 22 Left 955820964 3:62895011-62895033 CCTATCTCAGTTGACAGTGGGTG No data
Right 955820972 3:62895056-62895078 CCTCAGATAAGGGAGCTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955820972 Original CRISPR CCTCAGATAAGGGAGCTCGG GGG Intergenic