ID: 955821519

View in Genome Browser
Species Human (GRCh38)
Location 3:62901054-62901076
Sequence GCCTGAGGTCCTATAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955821519_955821526 23 Left 955821519 3:62901054-62901076 CCACCCACTATAGGACCTCAGGC No data
Right 955821526 3:62901100-62901122 TCCTTTCCTCCTAAGCGAAAGGG No data
955821519_955821525 22 Left 955821519 3:62901054-62901076 CCACCCACTATAGGACCTCAGGC No data
Right 955821525 3:62901099-62901121 CTCCTTTCCTCCTAAGCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955821519 Original CRISPR GCCTGAGGTCCTATAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr