ID: 955822465

View in Genome Browser
Species Human (GRCh38)
Location 3:62910443-62910465
Sequence AACTTCCACTATAAGAACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955822465_955822467 14 Left 955822465 3:62910443-62910465 CCGTGGTTCTTATAGTGGAAGTT No data
Right 955822467 3:62910480-62910502 CCTCCTCCTCCAGTGTCTGTAGG No data
955822465_955822470 21 Left 955822465 3:62910443-62910465 CCGTGGTTCTTATAGTGGAAGTT No data
Right 955822470 3:62910487-62910509 CTCCAGTGTCTGTAGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955822465 Original CRISPR AACTTCCACTATAAGAACCA CGG (reversed) Intergenic
No off target data available for this crispr