ID: 955822470

View in Genome Browser
Species Human (GRCh38)
Location 3:62910487-62910509
Sequence CTCCAGTGTCTGTAGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955822465_955822470 21 Left 955822465 3:62910443-62910465 CCGTGGTTCTTATAGTGGAAGTT No data
Right 955822470 3:62910487-62910509 CTCCAGTGTCTGTAGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955822470 Original CRISPR CTCCAGTGTCTGTAGGAAAA TGG Intergenic
No off target data available for this crispr