ID: 955822531

View in Genome Browser
Species Human (GRCh38)
Location 3:62911330-62911352
Sequence AACCCAGTGCTGTAATATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955822531_955822535 18 Left 955822531 3:62911330-62911352 CCAAAATATTACAGCACTGGGTT No data
Right 955822535 3:62911371-62911393 CAGGACAATCCAAATCTCATTGG No data
955822531_955822532 -1 Left 955822531 3:62911330-62911352 CCAAAATATTACAGCACTGGGTT No data
Right 955822532 3:62911352-62911374 TCATTGCCACCTCATAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955822531 Original CRISPR AACCCAGTGCTGTAATATTT TGG (reversed) Intergenic
No off target data available for this crispr