ID: 955822535

View in Genome Browser
Species Human (GRCh38)
Location 3:62911371-62911393
Sequence CAGGACAATCCAAATCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955822528_955822535 22 Left 955822528 3:62911326-62911348 CCTTCCAAAATATTACAGCACTG No data
Right 955822535 3:62911371-62911393 CAGGACAATCCAAATCTCATTGG No data
955822533_955822535 -10 Left 955822533 3:62911358-62911380 CCACCTCATAACACAGGACAATC No data
Right 955822535 3:62911371-62911393 CAGGACAATCCAAATCTCATTGG No data
955822531_955822535 18 Left 955822531 3:62911330-62911352 CCAAAATATTACAGCACTGGGTT No data
Right 955822535 3:62911371-62911393 CAGGACAATCCAAATCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955822535 Original CRISPR CAGGACAATCCAAATCTCAT TGG Intergenic
No off target data available for this crispr