ID: 955826930

View in Genome Browser
Species Human (GRCh38)
Location 3:62957324-62957346
Sequence CATTGGATATAGGTTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955826923_955826930 16 Left 955826923 3:62957285-62957307 CCTCTGGTTTAAGACGGCCAGGT No data
Right 955826930 3:62957324-62957346 CATTGGATATAGGTTTCCCCAGG No data
955826920_955826930 24 Left 955826920 3:62957277-62957299 CCACTGTGCCTCTGGTTTAAGAC No data
Right 955826930 3:62957324-62957346 CATTGGATATAGGTTTCCCCAGG No data
955826925_955826930 -1 Left 955826925 3:62957302-62957324 CCAGGTATTTAGTACACCTGGCC No data
Right 955826930 3:62957324-62957346 CATTGGATATAGGTTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955826930 Original CRISPR CATTGGATATAGGTTTCCCC AGG Intergenic