ID: 955830718

View in Genome Browser
Species Human (GRCh38)
Location 3:63000310-63000332
Sequence TTTATTTACTGTCATGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955830718_955830720 6 Left 955830718 3:63000310-63000332 CCATACACATGACAGTAAATAAA No data
Right 955830720 3:63000339-63000361 AAAGTATGGCATCAATATTCTGG No data
955830718_955830723 23 Left 955830718 3:63000310-63000332 CCATACACATGACAGTAAATAAA No data
Right 955830723 3:63000356-63000378 TTCTGGTTTTGATGTAACAGGGG No data
955830718_955830719 -8 Left 955830718 3:63000310-63000332 CCATACACATGACAGTAAATAAA No data
Right 955830719 3:63000325-63000347 TAAATAAATATGATAAAGTATGG No data
955830718_955830722 22 Left 955830718 3:63000310-63000332 CCATACACATGACAGTAAATAAA No data
Right 955830722 3:63000355-63000377 ATTCTGGTTTTGATGTAACAGGG No data
955830718_955830721 21 Left 955830718 3:63000310-63000332 CCATACACATGACAGTAAATAAA No data
Right 955830721 3:63000354-63000376 TATTCTGGTTTTGATGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955830718 Original CRISPR TTTATTTACTGTCATGTGTA TGG (reversed) Intergenic
No off target data available for this crispr