ID: 955830722

View in Genome Browser
Species Human (GRCh38)
Location 3:63000355-63000377
Sequence ATTCTGGTTTTGATGTAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955830718_955830722 22 Left 955830718 3:63000310-63000332 CCATACACATGACAGTAAATAAA No data
Right 955830722 3:63000355-63000377 ATTCTGGTTTTGATGTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955830722 Original CRISPR ATTCTGGTTTTGATGTAACA GGG Intergenic
No off target data available for this crispr