ID: 955835329

View in Genome Browser
Species Human (GRCh38)
Location 3:63048228-63048250
Sequence CTGTAGTTCCAGCACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955835320_955835329 27 Left 955835320 3:63048178-63048200 CCCTGCCTCTACAAAAAATACAA 0: 160
1: 5580
2: 78989
3: 179024
4: 203190
Right 955835329 3:63048228-63048250 CTGTAGTTCCAGCACTCAGGAGG No data
955835322_955835329 22 Left 955835322 3:63048183-63048205 CCTCTACAAAAAATACAAAAATA 0: 12
1: 574
2: 7712
3: 8235
4: 8737
Right 955835329 3:63048228-63048250 CTGTAGTTCCAGCACTCAGGAGG No data
955835321_955835329 26 Left 955835321 3:63048179-63048201 CCTGCCTCTACAAAAAATACAAA 0: 219
1: 10135
2: 190603
3: 225014
4: 130527
Right 955835329 3:63048228-63048250 CTGTAGTTCCAGCACTCAGGAGG No data
955835326_955835329 -3 Left 955835326 3:63048208-63048230 CCAGGCATGGTGGCACATGCCTG 0: 4990
1: 24542
2: 69205
3: 136900
4: 209223
Right 955835329 3:63048228-63048250 CTGTAGTTCCAGCACTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955835329 Original CRISPR CTGTAGTTCCAGCACTCAGG AGG Intergenic
No off target data available for this crispr