ID: 955839480

View in Genome Browser
Species Human (GRCh38)
Location 3:63096756-63096778
Sequence CAGCTCGGACAGCTTGGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955839474_955839480 -4 Left 955839474 3:63096737-63096759 CCCGCTGCAGGGCGGCCTCCAGC 0: 12
1: 16
2: 20
3: 49
4: 391
Right 955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG No data
955839472_955839480 5 Left 955839472 3:63096728-63096750 CCTGCTTGGCCCGCTGCAGGGCG 0: 8
1: 13
2: 16
3: 28
4: 136
Right 955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG No data
955839468_955839480 16 Left 955839468 3:63096717-63096739 CCACGCCATGTCCTGCTTGGCCC 0: 6
1: 7
2: 14
3: 32
4: 182
Right 955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG No data
955839469_955839480 11 Left 955839469 3:63096722-63096744 CCATGTCCTGCTTGGCCCGCTGC 0: 13
1: 9
2: 21
3: 34
4: 222
Right 955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG No data
955839475_955839480 -5 Left 955839475 3:63096738-63096760 CCGCTGCAGGGCGGCCTCCAGCT 0: 12
1: 14
2: 7
3: 33
4: 301
Right 955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955839480 Original CRISPR CAGCTCGGACAGCTTGGCGT TGG Intergenic
No off target data available for this crispr