ID: 955853574

View in Genome Browser
Species Human (GRCh38)
Location 3:63248062-63248084
Sequence GGTGATGCACAGAGGGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 346}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955853563_955853574 15 Left 955853563 3:63248024-63248046 CCAGAGCACTGAAGGGATACCTA 0: 1
1: 0
2: 0
3: 7
4: 78
Right 955853574 3:63248062-63248084 GGTGATGCACAGAGGGGCCTTGG 0: 1
1: 0
2: 0
3: 27
4: 346
955853568_955853574 -4 Left 955853568 3:63248043-63248065 CCTAACTGCCCAGGGGAAAGGTG 0: 1
1: 0
2: 1
3: 20
4: 194
Right 955853574 3:63248062-63248084 GGTGATGCACAGAGGGGCCTTGG 0: 1
1: 0
2: 0
3: 27
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955853574 Original CRISPR GGTGATGCACAGAGGGGCCT TGG Intronic
900842944 1:5070461-5070483 GGAAGTGCACAGATGGGCCTAGG - Intergenic
900883859 1:5401814-5401836 GGAAGTGCACAGATGGGCCTAGG - Intergenic
904601789 1:31676998-31677020 GATGGTGCACAGAGGTGCCAGGG - Intronic
904631043 1:31842556-31842578 GCTGCTGCACAGAGGTGGCTCGG - Intergenic
904758125 1:32780643-32780665 GGTTATGCACCCAGTGGCCTGGG - Intronic
905009399 1:34736983-34737005 GGTGCAGCACCGAGGGGCCAAGG - Intronic
905277182 1:36825791-36825813 GGTGATGGTCAGGGGGGCCACGG + Exonic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
907324690 1:53629307-53629329 TGTGAAGCACAGAGGGGATTGGG - Intronic
909611026 1:77552001-77552023 GGAAGTGCACAGATGGGCCTAGG - Intronic
911095313 1:94050054-94050076 GGTGGGGGACAGAGGGGCCCTGG - Intronic
911105368 1:94126396-94126418 GGGAATGCACAGAGAGGCCGAGG + Intergenic
913719298 1:121575268-121575290 GGTGATGTACAGAAGGGTTTTGG - Intergenic
913999428 1:143680116-143680138 GGAGCTGCAGAGAGGGGCCTCGG + Intergenic
914313754 1:146489390-146489412 GGAGCTGCAGAGAGGGACCTCGG + Intergenic
914475868 1:148021602-148021624 GGAGCTGCGGAGAGGGGCCTCGG + Intergenic
914500595 1:148243991-148244013 GGAGCTGCAGAGAGGGACCTCGG - Intergenic
917904612 1:179576106-179576128 GCTGAAGCAGAGAGAGGCCTGGG + Intergenic
920032032 1:203043364-203043386 CCTGAAGCACTGAGGGGCCTTGG + Intronic
920055883 1:203191363-203191385 GGAAGTGCACAGATGGGCCTAGG - Intergenic
920340566 1:205272824-205272846 GGTGAGGCTCAGGGGGGCCCTGG - Exonic
921078139 1:211716326-211716348 GATGAGGCACTGAGGGGCTTGGG - Intergenic
922232572 1:223699670-223699692 GGAAGTGCACAGATGGGCCTAGG - Intergenic
922599536 1:226839041-226839063 GAAGGTGCACAGATGGGCCTAGG + Intergenic
922751979 1:228074308-228074330 GGTGAGGGACAGAGAGGGCTGGG + Exonic
922777047 1:228219668-228219690 GGTGACGCAGAGAGGGGCAGAGG - Intronic
924609502 1:245562178-245562200 GCTGAGGCAGAGAGGGACCTGGG + Intronic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
924813635 1:247424468-247424490 GGTGATGAGCAGAGAGGCCTCGG - Exonic
1065699468 10:28410873-28410895 GTTGATGCTCAGAGAGTCCTGGG + Intergenic
1065771177 10:29080231-29080253 TGTGAAGCAGAGAGGAGCCTGGG + Intergenic
1067042154 10:42960702-42960724 GCTGAGGCTCAGAGGAGCCTGGG - Intergenic
1069637806 10:69936249-69936271 GGTGATGCACAGGGGCCCCATGG - Intronic
1069640993 10:69955473-69955495 GGTGAGGAACAGAGAGGCCAAGG - Intronic
1069798960 10:71070520-71070542 GGTGAGGCACAGAGAGGGCCAGG + Intergenic
1069936623 10:71921893-71921915 GGAGAGGCTCAGAGTGGCCTGGG + Intergenic
1069996174 10:72343456-72343478 GGGGGTGAGCAGAGGGGCCTCGG - Exonic
1070334384 10:75441236-75441258 AGTGAGGGGCAGAGGGGCCTAGG - Intronic
1070773191 10:79094616-79094638 AGTGATGCCCAGCGAGGCCTTGG - Intronic
1071258451 10:83896487-83896509 GGGAATACACAGAGGGCCCTTGG - Intergenic
1071563078 10:86658106-86658128 GGTGAAGAAGACAGGGGCCTGGG - Exonic
1073933226 10:108600137-108600159 GGTCCTGCACAGACGGGACTCGG - Intergenic
1075121668 10:119669147-119669169 GGAAGTGCACAGATGGGCCTAGG + Intronic
1076469523 10:130708780-130708802 GGGGAGCCACAGATGGGCCTCGG - Intergenic
1076660124 10:132050323-132050345 GGTGAGCCAGAGAGGTGCCTGGG - Intergenic
1076762777 10:132613712-132613734 GCGGCTGCACTGAGGGGCCTCGG + Intronic
1076792372 10:132784345-132784367 GCTGATGCGCAGAGGGACTTTGG + Intergenic
1077031851 11:471959-471981 GGTGATGCAGATGGCGGCCTGGG + Intronic
1077213035 11:1382313-1382335 GGGGACACCCAGAGGGGCCTGGG + Intergenic
1077354886 11:2111080-2111102 AGTGATGGACAGACGGTCCTTGG - Intergenic
1077502836 11:2917033-2917055 GGGGAGGCCCAGAGAGGCCTGGG + Intronic
1078091421 11:8266865-8266887 GGTGATGCTCAGAGAGGTATTGG + Intronic
1079131730 11:17750647-17750669 GATGATGCACATTGGGGCCCAGG - Intronic
1081534446 11:43987028-43987050 GGTGTGGCACAGCGGGGCCTGGG + Intergenic
1083593427 11:63908120-63908142 GGTGATGGGCAGAGGGCCCTGGG + Intronic
1083712168 11:64556196-64556218 GGAGATGGTCAGAAGGGCCTTGG - Exonic
1083878271 11:65536141-65536163 GGTGAGGCACAGCTGGGCCTGGG + Exonic
1083900418 11:65640796-65640818 GGGGCTGCTCAGAGGGGCCTGGG - Exonic
1084705074 11:70811366-70811388 GAGGATGCACAGTGGGGCCGTGG - Intronic
1085200008 11:74696227-74696249 GGTGCTGCAGTGGGGGGCCTGGG + Intergenic
1085309003 11:75505248-75505270 GGGCAAGCACAGATGGGCCTGGG + Intronic
1085336747 11:75702377-75702399 GGTGATGCCCACAGGAGCCAGGG + Intergenic
1086119151 11:83287391-83287413 GGAGACGGACAGAGGGGCATGGG - Intergenic
1088035455 11:105307264-105307286 GGTTATCCACAGAGGTTCCTCGG + Intergenic
1090270917 11:125385604-125385626 GGTGATGCACTCAGAGCCCTGGG - Exonic
1092192227 12:6529382-6529404 GGTGAGGCAGACAGGGGCCGTGG + Intronic
1093776067 12:23075791-23075813 GGTGATGTACAGATGGGTTTTGG + Intergenic
1094210517 12:27885395-27885417 GGTCATGCTCAGAGAGACCTTGG + Intergenic
1097387089 12:58962937-58962959 GGAGGTGCACAGATGGGCCTAGG - Intergenic
1098143576 12:67475449-67475471 GGTGAATCACTGAAGGGCCTAGG + Intergenic
1099926752 12:89027917-89027939 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1100751366 12:97701934-97701956 GGAAATGCACAGATGGGCCTAGG - Intergenic
1101880136 12:108620797-108620819 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1102042565 12:109810033-109810055 GGTGTGGCACAGAGAGGGCTGGG + Intronic
1104795055 12:131511536-131511558 GGTGCTGCTGAGAGAGGCCTGGG + Intergenic
1105896761 13:24723238-24723260 GATGAAGCAAAGAGGGGCCATGG - Intergenic
1106024126 13:25940926-25940948 GCTGATTCACAGAGAGGGCTGGG + Intronic
1106435745 13:29721646-29721668 GGCTTTGCACAGAGGGGCTTGGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107559250 13:41545523-41545545 TGAGATGCAGAGAGGGGCCTTGG - Intergenic
1108316326 13:49241117-49241139 GGGGGTGGGCAGAGGGGCCTGGG - Intergenic
1110095486 13:71513885-71513907 TGTGGAGGACAGAGGGGCCTGGG - Intronic
1112602653 13:100871878-100871900 GGTGAAGCACAGAGGACCTTAGG - Intergenic
1113876483 13:113597863-113597885 AGTGTTGCACAGAGGGGCCCTGG + Intronic
1114828307 14:26107259-26107281 GGTGATGTACAGATGGGTTTTGG - Intergenic
1116616129 14:47142100-47142122 GGAAATGAACACAGGGGCCTTGG - Intronic
1117511218 14:56453335-56453357 AGTGAAGGCCAGAGGGGCCTGGG + Intergenic
1118601511 14:67473830-67473852 GGTGATGTTCACAGCGGCCTGGG - Exonic
1121711820 14:96044095-96044117 GCTGATCCACAGAGGGTCCCTGG - Intronic
1122276780 14:100594759-100594781 GGTGATGCATAAAGGGCTCTGGG - Intergenic
1122717185 14:103702769-103702791 GGACGTGCACAGATGGGCCTAGG - Intronic
1122980710 14:105191292-105191314 AGGCATGCACAGAGGGGCCGGGG - Intergenic
1123631161 15:22260447-22260469 TGTGCTGCGCAGAGGGTCCTAGG + Intergenic
1123995972 15:25718331-25718353 GGTGGTGCCCAGAGGGGGCTCGG - Exonic
1124014181 15:25862455-25862477 GCGGAGGCACAGAGAGGCCTTGG + Intronic
1124364389 15:29061960-29061982 GGTCCTGCACAGAGGGGCTTTGG + Intronic
1124473372 15:30008829-30008851 GGTGATGCATAAAGGGCCCCAGG + Intergenic
1124513319 15:30346361-30346383 GGTGATGTACAGATGGGTTTTGG + Intergenic
1124729604 15:32184404-32184426 GGTGATGTACAGATGGGTTTTGG - Intergenic
1126368386 15:47919799-47919821 GGTTTTGCACAGATGTGCCTAGG - Intergenic
1126901727 15:53321477-53321499 GGAAATGCACAGATGGGCCCAGG - Intergenic
1127625951 15:60780332-60780354 GGTGATGTGCAGACAGGCCTGGG + Intronic
1128261699 15:66237174-66237196 CGTGATTCACAGGAGGGCCTGGG + Intronic
1128638273 15:69317200-69317222 AGTGAGGCCCAGAGGGGCTTCGG + Intronic
1128677914 15:69625247-69625269 TCTGATTCACAGAGGGGGCTTGG + Intergenic
1128820703 15:70650187-70650209 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1128997538 15:72307733-72307755 AGTGAGGCACAGAGGGACCAGGG + Intronic
1130561209 15:84960639-84960661 GGTGATGGGCAGGTGGGCCTGGG + Intergenic
1130897218 15:88180991-88181013 TGGGATGCCCAGAGGAGCCTGGG - Intronic
1130927789 15:88398189-88398211 TCTGATGCACAGACAGGCCTGGG - Intergenic
1131059792 15:89397599-89397621 GGGGCTGTCCAGAGGGGCCTGGG + Intergenic
1132638083 16:963138-963160 GGTGGGACACAGAGGGGACTCGG + Intronic
1132656860 16:1045040-1045062 AGGGAGGGACAGAGGGGCCTGGG + Intergenic
1132713050 16:1277793-1277815 AGTGCTGACCAGAGGGGCCTAGG + Intergenic
1133437650 16:5793576-5793598 GGAGGTGAAGAGAGGGGCCTGGG - Intergenic
1135054713 16:19221279-19221301 GGTGGTGCACTGATGGGCCTAGG + Intronic
1136073558 16:27803263-27803285 GGGCATGGACAGAGGGGCTTGGG - Intronic
1136297671 16:29312945-29312967 GGAGAGGCTCAGCGGGGCCTGGG - Intergenic
1136884375 16:33922517-33922539 GGGGTTCCCCAGAGGGGCCTTGG - Intergenic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1138768899 16:59638128-59638150 GATAAGGCAAAGAGGGGCCTGGG + Intergenic
1141497006 16:84417152-84417174 GGTGATGCCCATAGGGTACTTGG + Intronic
1142059223 16:88019023-88019045 GGAGAGGCTCAGGGGGGCCTGGG - Intronic
1142118715 16:88375307-88375329 ACTGAGGCACAGAGGGGCCAAGG + Intergenic
1142149575 16:88506696-88506718 GGAGAGGCGCAGAGGAGCCTGGG - Intronic
1142492101 17:285986-286008 CGGGGTGCACAGTGGGGCCTGGG - Intronic
1144438556 17:15261937-15261959 GGAGAGGAACAGAGGGGCCTGGG - Intronic
1144588201 17:16501747-16501769 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1144811889 17:18005833-18005855 GGTGATGCACAGATGTCACTGGG + Intronic
1144852048 17:18248811-18248833 GGTGCTGCTCAGTGTGGCCTGGG + Exonic
1144857458 17:18277653-18277675 GGTGAGGCAGGGAGGGGCATGGG - Exonic
1144951052 17:18993653-18993675 AGTGAGGCCCAGAGAGGCCTAGG - Intronic
1145791887 17:27632519-27632541 GGACCTGCACAGAGGGGGCTGGG + Intronic
1147883811 17:43670917-43670939 GCTGAGGCCCAGAGAGGCCTAGG + Intergenic
1148127012 17:45242184-45242206 GGAGATGGAGGGAGGGGCCTGGG + Intronic
1149158256 17:53660331-53660353 GGTCCTGAACACAGGGGCCTTGG + Intergenic
1150147116 17:62778264-62778286 GGTCAGGCACACAAGGGCCTTGG + Intronic
1150221080 17:63496310-63496332 TGTGATGTGCAGAAGGGCCTGGG + Intronic
1151153893 17:72111067-72111089 GGTGATGCACTGAGGGGTCATGG - Intergenic
1151369783 17:73640463-73640485 GGTGAGGGAAAGAGGGGCATGGG + Intronic
1154197550 18:12277464-12277486 GGGGAGGCATAGAGGGCCCTGGG + Intronic
1155939864 18:31792354-31792376 GGGGATGCCTAGAGGTGCCTGGG - Intergenic
1157182536 18:45510426-45510448 GGAGCCGCATAGAGGGGCCTGGG - Intronic
1159507452 18:69355785-69355807 GGAAATGCACAGATGGGCCTAGG - Intergenic
1159600314 18:70423007-70423029 GGAGAGACACAGAGGGGTCTGGG - Intergenic
1159985022 18:74831746-74831768 GGTGATGCACAGCAGGGCAGGGG - Intronic
1161003333 19:1922186-1922208 GGTCCTGCACAGAGGGACCCAGG + Intronic
1161593052 19:5137361-5137383 GGTGGTGCTCTGAGAGGCCTGGG + Intronic
1162628585 19:11906657-11906679 GGTGATGTACAGATGGGTTTTGG - Intronic
1163005423 19:14394272-14394294 TGAGACGCTCAGAGGGGCCTGGG + Intronic
1163290986 19:16378700-16378722 GGTGAGGCACAGGGGAGCCAGGG + Intronic
1163711360 19:18849156-18849178 GGAGATGCTCAGAGTGGCCATGG + Intronic
1163765832 19:19162763-19162785 GGCCATGCACAGAGAGGCCAGGG + Intronic
1164340738 19:24394886-24394908 GGTGATGTACAGATGGGTTTTGG - Intergenic
1164426901 19:28149733-28149755 GCTGAAGGACAGAGGGCCCTGGG + Intergenic
1165361279 19:35338389-35338411 GGTACTGGACAGAGGGGCCCGGG + Exonic
1165722152 19:38087097-38087119 GGAGGTGCACAGATGGGCCTAGG + Intronic
1165907256 19:39201700-39201722 GGAGATACACAAAGGGTCCTCGG - Exonic
1166105801 19:40597486-40597508 GGAGATGCAAAGAGGGCCCTTGG + Intronic
1168355657 19:55698182-55698204 GGGCATGCACGGATGGGCCTAGG + Intronic
925479398 2:4253220-4253242 GGCGATGCAGAGATGGGCCTTGG - Intergenic
926237160 2:11054629-11054651 GGTGATGTTCACAAGGGCCTGGG + Intergenic
927852371 2:26507943-26507965 TGTGGTGCACACAGGGTCCTAGG + Intronic
927913054 2:26915122-26915144 GGAGGTGCACAGAGGTGGCTGGG - Intronic
928443790 2:31315218-31315240 GGGGATGGACTGAGTGGCCTGGG + Intergenic
931150556 2:59568146-59568168 GGAGAAGCACAGATGGGCATGGG + Intergenic
931668467 2:64626536-64626558 GGTGATAAAGGGAGGGGCCTGGG + Intergenic
932294179 2:70610394-70610416 GGGGATGGACAGAGGATCCTGGG - Intronic
932447547 2:71790275-71790297 GGTCATGGACACAGGGGGCTAGG - Intergenic
932709237 2:74049611-74049633 TGTGATACACAGACGGGTCTTGG + Intronic
934976828 2:98808689-98808711 GGCCCTGCTCAGAGGGGCCTGGG + Intronic
935938507 2:108213710-108213732 GGTGATGTACAGATGGGTTTTGG + Intergenic
936416944 2:112324296-112324318 GGTGATGTCCAGGGGAGCCTGGG - Exonic
937263113 2:120598908-120598930 GGAGAGGCAAAGAGGGGCATTGG - Intergenic
938977608 2:136494740-136494762 GAAGGTGCACCGAGGGGCCTGGG + Intergenic
939924261 2:148154096-148154118 GGTGATGTACAGATGGGTTTTGG + Intronic
942377862 2:175355479-175355501 GGTGGAGCACAGAGGGCCCTTGG + Intergenic
942531318 2:176913197-176913219 GTCTATACACAGAGGGGCCTTGG + Intergenic
942734259 2:179092559-179092581 GGTGATGTACAGATGGGTTTTGG + Intergenic
944142861 2:196475963-196475985 GGTGAGGCACAGCGGGTCCGAGG - Intronic
945669533 2:212786097-212786119 GGTGATGTACAGATGGGTTTTGG - Intergenic
946235502 2:218322472-218322494 TGGGTGGCACAGAGGGGCCTAGG - Intronic
946366087 2:219249907-219249929 CATAATGCACAGAGGAGCCTGGG + Exonic
948433455 2:237935751-237935773 GGAAGTGCACAGAGGGGCCCAGG - Intergenic
948752042 2:240138512-240138534 GGTCAGGGACAGCGGGGCCTGGG - Intergenic
948901485 2:240958779-240958801 GGTGGTGTCCCGAGGGGCCTGGG + Intronic
948951061 2:241252081-241252103 GGTGAGGCACACAGCGACCTTGG + Intronic
1168940570 20:1707726-1707748 GATGGTGCACAGAGAGGGCTGGG + Intergenic
1169216597 20:3797749-3797771 GGTGAGGCCCAGGGGAGCCTGGG + Exonic
1171191507 20:23162655-23162677 GGCACTGGACAGAGGGGCCTGGG + Intergenic
1171768624 20:29303597-29303619 GGGTCTGCACAGTGGGGCCTGGG - Intergenic
1171908346 20:30919878-30919900 GGGTCTGCACAGTGGGGCCTAGG + Intergenic
1172872478 20:38144329-38144351 GGTGATTCAGAGAGAGGCCGCGG + Intronic
1174373836 20:50112682-50112704 GGTGCGGCTGAGAGGGGCCTTGG - Intronic
1174523993 20:51156826-51156848 GGGGGTGCACAGAGTGGCTTAGG + Intergenic
1174736708 20:52972178-52972200 GAGGGCGCACAGAGGGGCCTGGG + Intergenic
1175466015 20:59191724-59191746 GGGGATGCACGAAGGCGCCTCGG + Exonic
1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG + Intronic
1178875026 21:36407680-36407702 TGGGATGAAAAGAGGGGCCTGGG + Intronic
1179435518 21:41359660-41359682 GGTGAGGCACAGAGAGGCTAAGG + Intergenic
1179547789 21:42124259-42124281 GGTACTGGACACAGGGGCCTGGG + Intronic
1179794895 21:43776829-43776851 GGGGGTGGACAGAGGGGCCCAGG + Intergenic
1179905727 21:44422031-44422053 GCTCATCCGCAGAGGGGCCTGGG + Intronic
1179991316 21:44949501-44949523 GCTGCTGCACAGAGGGTTCTGGG - Intronic
1180162489 21:46004412-46004434 GATGCAGCACAGAGGTGCCTAGG - Exonic
1180341784 22:11626039-11626061 GGGTCTGCACAGTGGGGCCTAGG + Intergenic
1180815555 22:18787293-18787315 TGTGCTGCACAGAGTGGCCCCGG + Intergenic
1180855453 22:19042210-19042232 GGTGATGGTCAGAGGGGTGTTGG - Intronic
1180913560 22:19469994-19470016 GGTGAGCCACAGAAGGGACTGGG + Intronic
1180968049 22:19800767-19800789 GGTGATGCCCACAGGGCACTGGG + Intronic
1180983005 22:19888146-19888168 GGTGCTGCACTGCTGGGCCTGGG - Intronic
1181018436 22:20084973-20084995 GCCGAGGCACAGAGAGGCCTGGG - Intronic
1181047435 22:20222232-20222254 GGCCATGCACAGCGGGGGCTAGG + Intergenic
1181054898 22:20256265-20256287 GGTGACGCCCAGTGTGGCCTTGG - Intronic
1181201745 22:21221628-21221650 TGTGCTGCACAGAGTGGCCCCGG + Intronic
1181700011 22:24615343-24615365 TGTGCTGCACAGAGTGGCCCCGG - Intronic
1182090983 22:27594668-27594690 GGAGATGAAGAGAAGGGCCTGGG - Intergenic
1182577451 22:31282731-31282753 AGTAAAGCACAGAGGAGCCTGGG + Exonic
1184306924 22:43609917-43609939 GGTGATGCTCAGATCGGCCAGGG + Intronic
1184495726 22:44840181-44840203 GTTGATCCACACAGGGTCCTTGG + Intronic
1185117653 22:48946814-48946836 AATGAAGCACTGAGGGGCCTGGG - Intergenic
1185161429 22:49232244-49232266 TGGGAGGCACAGAGGGGTCTGGG + Intergenic
950354915 3:12399098-12399120 TGTGCTGCACAGATGGGGCTGGG - Intronic
950643328 3:14362283-14362305 GTTTCTGCAGAGAGGGGCCTTGG - Intergenic
954393490 3:50279727-50279749 ACTGATGCTCAGAGGGGCCAGGG + Intronic
955853574 3:63248062-63248084 GGTGATGCACAGAGGGGCCTTGG + Intronic
955964962 3:64379826-64379848 GGTGATGCAGGGAGAGCCCTTGG - Intronic
956704060 3:71984107-71984129 TGTGATGCCCAGAGGAGACTGGG + Intergenic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
959167738 3:102801551-102801573 GGTGATGCTAAAAGGGACCTGGG - Intergenic
959254232 3:103990120-103990142 GGAGAGGCTAAGAGGGGCCTTGG - Intergenic
959980902 3:112516552-112516574 GGAGGTGCACAGATGGGCCTAGG - Intergenic
960201767 3:114845492-114845514 GGTGAGGCACAGAGGTGGGTAGG - Intronic
960313816 3:116151238-116151260 AATGATGCACAGAGTGCCCTGGG + Intronic
960753090 3:120978701-120978723 GGTGATGTACAGATGGGTTTTGG + Intronic
960973762 3:123156787-123156809 GCTGAGGCACCGAGGGGGCTGGG + Intronic
960987647 3:123291094-123291116 TGAGGTGCACAGCGGGGCCTGGG - Exonic
961380187 3:126492002-126492024 GATTATCCCCAGAGGGGCCTTGG + Intronic
961380384 3:126492785-126492807 GATTATCCCCAGAGGGGCCTTGG + Intronic
961592143 3:127988974-127988996 GGTGATCCACAGAGGGGGACGGG + Intergenic
962391772 3:134978274-134978296 GAAGATGCACTGAGGGGCCAGGG - Intronic
963774410 3:149423403-149423425 GGAAATACACAGATGGGCCTAGG + Intergenic
965107798 3:164380351-164380373 GATGCTGCACAGAGAGGCCAAGG - Intergenic
965463115 3:168993450-168993472 GGAAGTGCACAGATGGGCCTAGG - Intergenic
966225620 3:177594341-177594363 GGAAATGCACAGATAGGCCTAGG + Intergenic
966851441 3:184167537-184167559 GGTGAGGCAGAAAGGGGCTTTGG - Intronic
967156367 3:186696210-186696232 AATGCTGCACAGAGGGGCCATGG - Intergenic
968547875 4:1207885-1207907 GCTGGTGCTCAGAGGGGCCGGGG + Intronic
968718064 4:2176779-2176801 GGAGATGCACACAGAGGCCCTGG + Intronic
970114867 4:12683674-12683696 GGTGATGGATAGAGTGGCCAAGG + Intergenic
970471258 4:16381471-16381493 GGAGGTACACAGATGGGCCTAGG + Intergenic
971562832 4:28103142-28103164 GGCAAGGCACAGAGGGGCTTTGG + Intergenic
972474360 4:39436354-39436376 GGCCATGCACATAGGGGCCAAGG + Intronic
974697635 4:65396712-65396734 GGAAAGGCAAAGAGGGGCCTTGG + Intronic
976905021 4:90226661-90226683 GGTGCTTCACAAAGGGGCTTTGG + Intronic
977406188 4:96602513-96602535 GGTGGTGAAGAGAGGGGACTTGG - Intergenic
979689200 4:123542829-123542851 GGAAGTGCACAGATGGGCCTAGG - Intergenic
979789673 4:124763526-124763548 TGTGATGCCCAAAGGAGCCTGGG - Intergenic
979919786 4:126481418-126481440 GGAGAGGCTAAGAGGGGCCTTGG + Intergenic
981455858 4:144952491-144952513 GGGCATGCATAGAGGGGCCAAGG - Intergenic
982691165 4:158549607-158549629 GGTGATGTACAGAGGGTTTTTGG + Intronic
983101675 4:163633081-163633103 GGTGATGTACAGATGGGTTTTGG - Intronic
983694336 4:170510251-170510273 GGTGACGTACAGAGGGGTTTTGG + Intergenic
985535975 5:465972-465994 GGTGCGGCACAGCGGGGCCCAGG + Intronic
988922978 5:35961862-35961884 GGAGAGGCTAAGAGGGGCCTTGG - Intronic
989086236 5:37679388-37679410 GGTGATGTACAGATGGGTTTTGG + Intronic
989295951 5:39826804-39826826 GGAGTTGCACAGAGAGGCCAGGG + Intergenic
989949552 5:50281066-50281088 GGTGATGTACAGATGGGTTTTGG - Intergenic
990487168 5:56270656-56270678 GGCAATGTACTGAGGGGCCTTGG + Intergenic
990843020 5:60104848-60104870 GGTGATGTACAGATGGGTTTTGG - Intronic
991451085 5:66751131-66751153 GGTGATGTACAGATGGGTTTTGG - Intronic
992435458 5:76751655-76751677 TGTGAAGCACAGAGGTGCCCAGG + Intergenic
992676635 5:79112094-79112116 GGGGAGGCTCAGAGGCGCCTTGG - Intronic
993152156 5:84174581-84174603 GTTGATGCAGAGAGGGTCCAAGG + Intronic
993488579 5:88517604-88517626 CGTGAACCACAGAGAGGCCTGGG - Intergenic
994424154 5:99562901-99562923 GGTGATGTACAGATGGGTTTTGG + Intergenic
998998584 5:147894584-147894606 AGTTATGCATAAAGGGGCCTTGG - Intronic
999910062 5:156187989-156188011 GGTGAGGCAGTGAGGTGCCTAGG + Intronic
1000329987 5:160198611-160198633 GGTGAGTGAAAGAGGGGCCTGGG - Intronic
1002597807 5:180335503-180335525 CGTGAGGGACTGAGGGGCCTGGG - Intronic
1002644790 5:180647874-180647896 GGTGGAGCACAGAGGGACGTGGG - Intronic
1003348898 6:5297217-5297239 GGTGAGGCACAGAGAGTCCAAGG + Intronic
1004777503 6:18864284-18864306 TGTGAAGCACAGAGGGATCTTGG + Intergenic
1006328511 6:33372432-33372454 GGTGGTGCCCAGATGGGCCATGG + Intergenic
1007755385 6:44096051-44096073 GGTGAAGCAGGGCGGGGCCTGGG - Intergenic
1008373101 6:50758894-50758916 GGAAATGCAAAGATGGGCCTAGG + Intronic
1008879105 6:56362759-56362781 GGTTCTTAACAGAGGGGCCTAGG - Intronic
1010004816 6:70984102-70984124 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1010508829 6:76692154-76692176 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1010721325 6:79285642-79285664 GGTGATGTACAGATGGGGTTTGG - Intergenic
1012089452 6:94873439-94873461 GGTGATGTACAGATGGGTTTTGG + Intergenic
1012303738 6:97623768-97623790 GGTGATACACGGAGGGCACTGGG + Intergenic
1012654044 6:101793364-101793386 GGTGATGTACAGATGGGTTTTGG + Intronic
1014219614 6:118786896-118786918 GGTGATGCAGAGGTGGGCCCAGG - Intergenic
1015220131 6:130794936-130794958 GGTGCTGCACAGACTTGCCTTGG - Intergenic
1015996402 6:138999260-138999282 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1018455808 6:163951289-163951311 GGTGGAGCACAGTAGGGCCTGGG + Intergenic
1018724037 6:166596979-166597001 GGAGCTGCAGAGAGAGGCCTGGG + Intronic
1018985917 6:168637009-168637031 GTGGATGCACAGAGAGGACTTGG - Intronic
1019294237 7:265538-265560 GGTGGTGCAGAGAGGGGGCGGGG + Intergenic
1019324201 7:430036-430058 GGTCCTGCACAGAGCGCCCTTGG + Intergenic
1019349051 7:544640-544662 GGCGAGGCACAGAGAGGCCAAGG + Intergenic
1019777882 7:2923269-2923291 TGTGCTGCACCGAGGGCCCTGGG + Exonic
1020021589 7:4872547-4872569 GGTGCCCCACAGAGGGGCCTGGG - Intronic
1022378841 7:29841029-29841051 GGGAGTGCACAGATGGGCCTGGG + Intronic
1023852461 7:44158030-44158052 GGAGAGGAACAGAAGGGCCTGGG + Intronic
1023868942 7:44252447-44252469 GGTGCAGCACAGAGGGGCAGGGG + Intronic
1024751048 7:52466113-52466135 GGTGGAGCACAGAGAGGCCCTGG + Intergenic
1029310469 7:99659233-99659255 GGTGATGTACAGATGGGTTTTGG + Intronic
1029312079 7:99676768-99676790 GTTCATTCACAGAGAGGCCTTGG + Intronic
1030785057 7:113650030-113650052 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1031504125 7:122559818-122559840 GGTGGTGCCCAGAGGGTTCTCGG - Intronic
1032345125 7:131109896-131109918 TGTGGTGCACAGTGGGGCCAAGG + Intergenic
1032767301 7:135009584-135009606 GGAGATGCATAGATGGGTCTGGG + Intronic
1032917757 7:136511098-136511120 GGAGAGGCTAAGAGGGGCCTTGG - Intergenic
1033991048 7:147287422-147287444 GGAATTGCACAGATGGGCCTTGG + Intronic
1035179693 7:157080299-157080321 AGTGATGCGGAGAGGGGCCAGGG - Intergenic
1035470666 7:159106820-159106842 GGAGATGCAGAGAGAGGCCAGGG + Intronic
1035791183 8:2307122-2307144 GGTGATGTACAGATGGGTTTTGG + Intergenic
1035801622 8:2414583-2414605 GGTGATGTACAGATGGGTTTTGG - Intergenic
1036151690 8:6305074-6305096 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1036530079 8:9577001-9577023 GGGGAAGCAAAGAGGGGACTAGG + Intronic
1037299337 8:17434677-17434699 GGTCATGCACCCAGAGGCCTGGG + Intergenic
1038438357 8:27554558-27554580 GGTGATGAACAGATGGGTTTTGG + Intergenic
1038691493 8:29767808-29767830 GGTGTGGCTCAGCGGGGCCTGGG - Intergenic
1039733920 8:40309549-40309571 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1041411525 8:57561394-57561416 GGGGATGTACTGAGGGCCCTGGG - Intergenic
1042341507 8:67684728-67684750 GGAAATGGACAGATGGGCCTAGG - Intronic
1042386969 8:68187893-68187915 GGAGGTGGACAGAGGGGGCTGGG + Intronic
1042580077 8:70267130-70267152 GGTGGTGCACAGTGGAGCCCAGG - Intronic
1043722319 8:83560462-83560484 AGTGATGCACAGATGGGTCAGGG + Intergenic
1044510323 8:93069947-93069969 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1047441799 8:124885239-124885261 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1048541396 8:135345218-135345240 AATGCTGCACATAGGGGCCTTGG - Intergenic
1048567324 8:135615182-135615204 GGAGCTCCACAGATGGGCCTAGG + Intronic
1048897072 8:139001675-139001697 GCTGAGGCACAGAGAGGCATAGG + Intergenic
1049197210 8:141322508-141322530 GGCAATGGACAGAGGGGCCAGGG - Intergenic
1049206834 8:141367439-141367461 ACCGAGGCACAGAGGGGCCTGGG + Intergenic
1049505134 8:142992148-142992170 GGAAAGGCACAGATGGGCCTGGG + Intergenic
1049553491 8:143271273-143271295 GCTGAGGCACAGCGGGGCCTGGG + Intronic
1049612173 8:143560854-143560876 GGAGCTGCTCCGAGGGGCCTTGG - Intronic
1052484274 9:29076001-29076023 GGTGGTGCACAGAGAGGCTGTGG - Intergenic
1052997544 9:34559287-34559309 TGTGATGCTGGGAGGGGCCTGGG + Intronic
1053009769 9:34626315-34626337 GGTGATGCTCAGAAGCTCCTGGG + Intronic
1053537185 9:38937619-38937641 GGAAGTGCACAGATGGGCCTTGG + Intergenic
1054628950 9:67426311-67426333 GGAAGTGCACAGATGGGCCTTGG - Intergenic
1056000421 9:82210515-82210537 GGACATGCTCAGAGGGACCTTGG + Intergenic
1056259674 9:84835315-84835337 GGTCATGCACAGATGGGCACTGG - Intronic
1057261472 9:93587193-93587215 GGTGAGGGACAGAGGAGCCCCGG + Intronic
1059335884 9:113568187-113568209 GGTGCAGTACAGAGAGGCCTGGG - Intronic
1060554646 9:124501956-124501978 AGGGAGGCAAAGAGGGGCCTGGG + Intronic
1061306591 9:129736166-129736188 GGAGATGTACGGAGGGGCGTGGG - Intergenic
1061494459 9:130963756-130963778 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1062085521 9:134646090-134646112 GCTGATGTGCAGAGAGGCCTGGG - Intronic
1062154607 9:135039708-135039730 GGAGCTGCTCAGCGGGGCCTCGG - Intergenic
1062212439 9:135372266-135372288 AGGGATGCACAGTGAGGCCTGGG + Intergenic
1062229403 9:135473058-135473080 TCTGGGGCACAGAGGGGCCTGGG + Intergenic
1062612175 9:137380292-137380314 GGGGACGCCCAGAGGGGCATTGG - Intronic
1062612320 9:137380599-137380621 GGGGATGCCCAGAGGGGCATTGG - Intronic
1062612345 9:137380654-137380676 GGGGATGCCCAGAGGGGGGTTGG - Intronic
1185499431 X:585517-585539 AGGGGTGCACAGAGGGGCCTGGG - Intergenic
1186277156 X:7951942-7951964 GGTGATGCACATTGGATCCTTGG - Intergenic
1186514188 X:10153981-10154003 GGGGATGGTCAGAGGCGCCTGGG + Intergenic
1190110204 X:47584427-47584449 GGAAGTGCACAGATGGGCCTAGG + Intronic
1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG + Intergenic
1190707493 X:53043001-53043023 GGTGATAAACAGAGGGGCACAGG + Intergenic
1192436309 X:71145610-71145632 GGGGATTCACAGTGGGTCCTAGG + Intronic
1195402606 X:104477586-104477608 GTTGATGCTCAGAGTGACCTTGG + Intergenic
1195721967 X:107876410-107876432 GGAGAGGCTAAGAGGGGCCTTGG - Intronic
1198553432 X:137768472-137768494 GGTGATGTACAGATGGGTTTTGG + Intergenic
1198615760 X:138456812-138456834 GGTGATGTACAGATGGGTTTTGG - Intergenic
1200205315 X:154311304-154311326 GGAGAGGCTTAGAGGGGCCTAGG + Intronic
1201589648 Y:15601036-15601058 GGAAGTGCACAGATGGGCCTGGG - Intergenic
1201942572 Y:19475585-19475607 GGTGCTGCGAAGAGGGGTCTGGG + Intergenic