ID: 955853978

View in Genome Browser
Species Human (GRCh38)
Location 3:63253379-63253401
Sequence TAAACAACTGTAGCATCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955853977_955853978 0 Left 955853977 3:63253356-63253378 CCAAAACAAACTCTTGAATGTTT 0: 1
1: 0
2: 3
3: 52
4: 576
Right 955853978 3:63253379-63253401 TAAACAACTGTAGCATCATTTGG 0: 1
1: 0
2: 2
3: 11
4: 151
955853976_955853978 3 Left 955853976 3:63253353-63253375 CCTCCAAAACAAACTCTTGAATG 0: 1
1: 0
2: 3
3: 35
4: 270
Right 955853978 3:63253379-63253401 TAAACAACTGTAGCATCATTTGG 0: 1
1: 0
2: 2
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955853978 Original CRISPR TAAACAACTGTAGCATCATT TGG Intronic
903644540 1:24886608-24886630 AAAACAACTGCAGCAGTATTTGG + Intergenic
904819278 1:33230405-33230427 AAAACGACTGTAGCCTCTTTAGG - Intergenic
906805271 1:48774581-48774603 TAAAAAACCCAAGCATCATTTGG - Intronic
907086431 1:51679480-51679502 TAAACAACTGAAGGATCAGAAGG - Intronic
908585987 1:65569335-65569357 AACACAATTGTTGCATCATTTGG + Intronic
909327483 1:74369194-74369216 TAAACAATTGTAGGTTCTTTTGG + Exonic
911962081 1:104318480-104318502 AAAACAATTGTAGAATCTTTGGG + Intergenic
912065110 1:105729055-105729077 TCCACAACTGTAGTATCAATGGG + Intergenic
914409781 1:147415133-147415155 TAAACAACTATAGTATCCCTGGG + Intergenic
915655428 1:157355601-157355623 TGATCAAATGTAGCATCACTAGG + Intergenic
917043213 1:170829382-170829404 AAAACACCTGTAGCATGGTTGGG - Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
918174451 1:182030286-182030308 TAAATACCTGGAGCATCATCAGG - Intergenic
922625368 1:227035725-227035747 TAAATAACTGTTTTATCATTTGG + Intronic
924314391 1:242780831-242780853 CAAATAACTGTAGTATAATTAGG + Intergenic
1064577855 10:16763952-16763974 TAAATGAATGAAGCATCATTAGG + Intronic
1066163652 10:32761806-32761828 TAAACATCCCTAGCTTCATTAGG - Intronic
1066335680 10:34475648-34475670 TAAAGAAATGTATCAACATTTGG - Intronic
1068009995 10:51436380-51436402 GAAAAAACTGCAGCATCAGTTGG - Intronic
1068820367 10:61369946-61369968 GGAAGAAGTGTAGCATCATTAGG + Intergenic
1071014389 10:80977928-80977950 TAAACCACTTTAGCAGGATTTGG + Intergenic
1071304543 10:84286885-84286907 TAAACAACTGTAACAGCACAAGG - Intergenic
1072503439 10:96042198-96042220 TAAACAACTTTATAATAATTTGG - Intergenic
1075829739 10:125398012-125398034 TAAAAAACTTTAGCACAATTTGG - Intergenic
1078829489 11:14965927-14965949 TCAACAACCATAGCATCCTTTGG - Intronic
1079186536 11:18243212-18243234 TAATTAACTGAAGCAACATTTGG - Intronic
1079701464 11:23553706-23553728 TAATCAACTCTAGCAGTATTGGG - Intergenic
1079913601 11:26340684-26340706 CTAATAACTGTAGCATCAATTGG - Intronic
1080936971 11:36874323-36874345 CAAACTACTGAACCATCATTAGG - Intergenic
1080937933 11:36882881-36882903 TAAACAACTGTTGGGGCATTTGG + Intergenic
1081092710 11:38892559-38892581 TAAGCTACTGTAAAATCATTGGG - Intergenic
1082654481 11:55836677-55836699 TAAACAATTGTATTATCTTTGGG - Intergenic
1085363276 11:75912365-75912387 TTAACAACTGCGGCATCACTCGG + Intronic
1087633552 11:100678079-100678101 TAAACAACATCAGCATCATCTGG - Intergenic
1090032069 11:123215762-123215784 TAGCCAAGTGTAGCATTATTAGG - Intergenic
1093082030 12:14823315-14823337 TAAACAGCAGTAACATCCTTGGG + Exonic
1093797816 12:23334682-23334704 TATACAGCTTTAGCATAATTTGG + Intergenic
1095640186 12:44478228-44478250 CATTCATCTGTAGCATCATTGGG - Intergenic
1097420509 12:59372859-59372881 TGATCAACTATAGCATCACTAGG + Intergenic
1099617076 12:84949541-84949563 TGAACAACTGTTCCATGATTGGG + Intergenic
1101257727 12:102995928-102995950 TTTACAACTTTACCATCATTTGG + Intergenic
1101268337 12:103115839-103115861 TATAAAACTGTAGCTTGATTTGG + Intergenic
1101486314 12:105165137-105165159 TAAAGAACTGTAAAATCATAGGG + Intronic
1104832817 12:131765781-131765803 TAACCAACTGTCGGATCATTTGG + Intronic
1105483062 13:20797573-20797595 TAAACAATTGTATTATCATATGG - Intronic
1107868127 13:44723457-44723479 TAAGGAACTGTAGAATCACTAGG - Intergenic
1110332368 13:74287508-74287530 TAAGCAAGTATAGCATAATTTGG - Intergenic
1110713812 13:78679056-78679078 TTAAAAACTGTAGTATCAATAGG + Intergenic
1110981130 13:81899700-81899722 TAAACTACTTTAACAACATTTGG + Intergenic
1111105307 13:83637880-83637902 TCAACAACATTAGCATCACTTGG + Intergenic
1112395345 13:99025401-99025423 TAAGCAAGTGAAGAATCATTGGG + Intronic
1112555154 13:100460551-100460573 TTAAGAACTTTAGCATCATTTGG - Intronic
1112858735 13:103804001-103804023 TAAACAAATGTAAAATTATTAGG - Intergenic
1202857590 14_GL000225v1_random:60694-60716 TAAACAACTGTCCCATCACCTGG - Intergenic
1125735839 15:41925154-41925176 TAAACAAGTTTAGCAGCCTTGGG - Intronic
1126961926 15:54006225-54006247 TAAACAAAAGTAGCAGCAATGGG + Intergenic
1127133880 15:55898360-55898382 TAAACAACACTAGCATTAGTGGG + Intronic
1134348107 16:13410399-13410421 AAAAGAACTGTTGCCTCATTGGG - Intergenic
1141843838 16:86593557-86593579 TAAACAACAGTAGAATTAATGGG + Intergenic
1144479838 17:15619983-15620005 TAAACATATTTAGCATCATTGGG - Intronic
1144918464 17:18743753-18743775 TAAACATATTTAGCATCATTGGG + Intergenic
1145782751 17:27574034-27574056 TAAACATCTCTATCATCATCTGG + Intronic
1149248011 17:54734402-54734424 TAAACAACTCTATAATTATTAGG + Intergenic
1149282021 17:55116463-55116485 TAAGTGTCTGTAGCATCATTGGG - Intronic
1152922241 17:83071842-83071864 AAAACAACTGCAGCCTCATGGGG - Intergenic
1155451498 18:25968523-25968545 TAAACAATTGTGTCATCATGTGG - Intergenic
1156586459 18:38436506-38436528 AAACCAACTGTAGCATGATTTGG + Intergenic
1158768241 18:60482335-60482357 TAAAAAATTGCAGCATAATTGGG + Intergenic
1158875475 18:61730319-61730341 TAACCAACTCTAGGATCATAAGG - Intergenic
925779033 2:7363068-7363090 TAACTAACTGTTCCATCATTTGG + Intergenic
928052972 2:28020140-28020162 AAAACAAATCTTGCATCATTTGG - Intronic
928678606 2:33675801-33675823 AAAAAAAATGTAGCATCCTTTGG + Intergenic
931614052 2:64137582-64137604 TGGATAATTGTAGCATCATTTGG - Intronic
931805174 2:65797207-65797229 TAAGCAGTTGTAACATCATTGGG + Intergenic
933180282 2:79218646-79218668 TAAACTACTGTAGCACTATAGGG + Intronic
933189433 2:79317228-79317250 TAAACAAATCTCGCATTATTGGG + Intronic
940496364 2:154433937-154433959 TAAAGAATTTTGGCATCATTAGG + Intronic
941927141 2:170907343-170907365 TAAACAGCTATACCATCACTAGG + Intergenic
945006452 2:205412372-205412394 TAAACAACAGTAACAACAATGGG + Intronic
946619198 2:221542803-221542825 TAAACAAATGTAGGATTCTTTGG - Intronic
1174175493 20:48642046-48642068 TGAACGACTGTAGGATCATCAGG - Intronic
1174880977 20:54279403-54279425 TAAATATCTGTTGCATCAATGGG - Intergenic
1175085840 20:56458187-56458209 TAGACAACTGTTGCAGTATTGGG + Intronic
1175649944 20:60711752-60711774 TAAATAACAGTAGCATCTTACGG - Intergenic
1176970820 21:15263524-15263546 TACACAGCTGCAGTATCATTTGG - Intergenic
1182002361 22:26930355-26930377 TAGACACCTTCAGCATCATTTGG - Intergenic
949315932 3:2755363-2755385 TAATCAACTTTAGAAACATTTGG + Intronic
950869679 3:16218055-16218077 CAAACAACTGTATCATCTCTGGG + Intronic
953153178 3:40343855-40343877 TAAGAGACTGTAGCACCATTTGG + Intergenic
954958998 3:54548262-54548284 TAAATAAATGTAGCCACATTAGG + Intronic
955000804 3:54925792-54925814 TAAACAACAGTAGCCACATGTGG + Intronic
955853978 3:63253379-63253401 TAAACAACTGTAGCATCATTTGG + Intronic
959817263 3:110689129-110689151 TGAAAAATTGTAGCATCATTGGG - Intergenic
960550842 3:118974551-118974573 TAAACCACTGTAGGATTCTTAGG - Intronic
962624262 3:137209960-137209982 TTAACAACTGTCTCCTCATTAGG - Intergenic
963284021 3:143415529-143415551 TAAACAGATGTGGCATCATCAGG - Intronic
963807880 3:149744570-149744592 TAAACAACTGCATAATAATTAGG + Intronic
965031605 3:163376169-163376191 AAAACAATTTTAGCATTATTTGG - Intergenic
965126537 3:164637904-164637926 AAAAAAACTGTAGCACCATACGG + Intergenic
965340572 3:167485854-167485876 TCAACCACTCTAGCAACATTGGG - Intronic
966419626 3:179724552-179724574 TGAACAGCCGTAGCATAATTAGG + Intronic
970918390 4:21363468-21363490 TAACCAACTGCATCAACATTAGG + Intronic
971186421 4:24381787-24381809 TATACAACTCTTTCATCATTAGG + Intergenic
975926635 4:79463355-79463377 TAAATAATTTTAACATCATTGGG + Intergenic
977440458 4:97059807-97059829 TAAACAACTCCAGCTTCATAAGG + Intergenic
978178106 4:105759118-105759140 TATACAACTGTAGCAGAAGTAGG + Intronic
978439467 4:108718340-108718362 TAACCAACTGCAGAATCTTTGGG + Intergenic
979075860 4:116268941-116268963 TAAGCAAATGAAGCATTATTTGG - Intergenic
981109983 4:140924144-140924166 TAAACATCAGTAGCATCTTTTGG - Intronic
981450507 4:144891597-144891619 TCAACGACTTTAGCATTATTGGG - Intergenic
981855938 4:149292683-149292705 TAAACAATTCTGGAATCATTAGG + Intergenic
983515819 4:168655566-168655588 CAACCAACTGAAGCATCATTTGG + Intronic
984426095 4:179587657-179587679 TAAACAGCTCCAGCAACATTTGG + Intergenic
986850050 5:11801341-11801363 GAAGCAACTGTATCATCAGTCGG - Intronic
990500649 5:56393614-56393636 TAAACAACTTTAGCAAATTTTGG + Intergenic
994388405 5:99160213-99160235 TTAGCAACTGTATCAACATTGGG + Intergenic
994787303 5:104180913-104180935 CATTCATCTGTAGCATCATTAGG - Intergenic
995281943 5:110345627-110345649 TAAACAACAGCAGCCTCACTAGG - Intronic
995490741 5:112689188-112689210 GAAAAAACTGTGTCATCATTGGG + Intergenic
995657505 5:114443451-114443473 GAAAGAACTTTAGAATCATTAGG + Intronic
1000191292 5:158913577-158913599 TAAACAACTGAAGCATTAACTGG + Intronic
1000666206 5:164000773-164000795 TAAACAAATATATCATCATTGGG + Intergenic
1004873613 6:19933113-19933135 TAAACAAATGTAGCATAAGCAGG - Intergenic
1008970322 6:57359676-57359698 AAAACAACTGTACTATGATTTGG + Intronic
1009159289 6:60261500-60261522 AAAACAACTGTACTATGATTTGG + Intergenic
1011071184 6:83386387-83386409 TAAACTACTTTAGAATCCTTAGG - Intronic
1011211668 6:84961973-84961995 TAAAGAAATGTATCAACATTTGG - Intergenic
1013061920 6:106643005-106643027 TGAACTACTGTAGCATTATAAGG - Exonic
1015334169 6:132017527-132017549 TAAATAAGTGTAGCATGAATGGG - Intergenic
1015442673 6:133267126-133267148 GAAACCATTTTAGCATCATTTGG + Intronic
1015509775 6:134026802-134026824 TAAACAGCTGTGGCAAGATTGGG - Intronic
1017200265 6:151745460-151745482 TAATCTATTTTAGCATCATTTGG + Intronic
1020588968 7:10109806-10109828 ACTACAACTGTAGCATCATATGG - Intergenic
1022611484 7:31878808-31878830 TTAATCTCTGTAGCATCATTAGG - Intronic
1022620495 7:31978972-31978994 TAAACAAGTGTGGCATCATTTGG - Intronic
1024139088 7:46443586-46443608 TAAACAACAATAACATTATTGGG + Intergenic
1025797241 7:64750373-64750395 TAAACAACTTTGTCATAATTTGG - Intergenic
1027555071 7:79653929-79653951 CAAGCTACTGTGGCATCATTTGG + Intergenic
1028887754 7:95953223-95953245 TAAGCAACTGTAGCATCTTTTGG + Intronic
1029562826 7:101314796-101314818 TAAACTACTGTTGTATCATTGGG + Exonic
1029945295 7:104526796-104526818 TAAACAACTGTTGAATGAGTGGG - Intronic
1032489894 7:132316700-132316722 GACACCACTGTAGCTTCATTAGG + Intronic
1032602557 7:133314707-133314729 GTAACAACTGTTTCATCATTAGG + Intronic
1036057790 8:5278699-5278721 TATAAAAGTGTAGCATCATTAGG - Intergenic
1038703109 8:29869684-29869706 TAATCATCTGTTGCTTCATTTGG - Intergenic
1040095991 8:43443205-43443227 TTAACTACTGTAGAATCATAAGG + Intergenic
1042023088 8:64391662-64391684 TAAACAACTTTAACTTTATTTGG - Intergenic
1045630675 8:104118118-104118140 TAAACTCCTGTATCATCATGAGG - Intronic
1046732898 8:117744874-117744896 TAATAAACTGAAGCAGCATTTGG - Intergenic
1047551708 8:125880721-125880743 TACACAACAGTAACATAATTAGG - Intergenic
1047794442 8:128239838-128239860 TAAACAACTGTGGGATGAATTGG - Intergenic
1050332510 9:4559828-4559850 GAAACAACTGAATCATCTTTCGG - Intronic
1050918953 9:11174812-11174834 TAAACAACTGTAATTTCACTGGG + Intergenic
1051359223 9:16266962-16266984 TAAACCTTTGTAGCATCATGTGG + Intronic
1057815772 9:98293037-98293059 TCACCAATTGCAGCATCATTTGG - Intronic
1185947754 X:4396773-4396795 TTTACAACTGTATGATCATTGGG + Intergenic
1186228328 X:7425467-7425489 TGAACAACTCTACCATTATTAGG + Intergenic
1186351331 X:8742629-8742651 TAAACAACTGTCACATCAGCAGG - Intergenic
1189604937 X:42667040-42667062 TAACCAACTGTAGCCTGTTTGGG - Intergenic
1190708103 X:53047753-53047775 GGAACCACTGAAGCATCATTTGG + Intergenic
1192506023 X:71684365-71684387 TAAACAACAATAGCTCCATTAGG + Intergenic
1192520674 X:71797177-71797199 TAAACAACAATAGCTCCATTAGG - Intergenic
1195815464 X:108880183-108880205 TAAAAAACTGTAACAGAATTTGG + Intergenic
1200344936 X:155438844-155438866 TTAACATCTGGAGCATCTTTTGG - Intergenic
1201414549 Y:13735181-13735203 TAAACAACTGTCACATCAGCAGG + Intergenic